ID: 1189276114

View in Genome Browser
Species Human (GRCh38)
Location X:39787325-39787347
Sequence GCATCGGAGGGCCCCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 8, 2: 6, 3: 16, 4: 47}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189276114_1189276125 29 Left 1189276114 X:39787325-39787347 CCCTTGAGGGGGCCCTCCGATGC 0: 1
1: 8
2: 6
3: 16
4: 47
Right 1189276125 X:39787377-39787399 ATTTGGCAGGTTTTTCCAGACGG 0: 8
1: 13
2: 10
3: 61
4: 442
1189276114_1189276119 -3 Left 1189276114 X:39787325-39787347 CCCTTGAGGGGGCCCTCCGATGC 0: 1
1: 8
2: 6
3: 16
4: 47
Right 1189276119 X:39787345-39787367 TGCCTGCTTCACCACCTTCTTGG 0: 1
1: 2
2: 1
3: 37
4: 275
1189276114_1189276123 12 Left 1189276114 X:39787325-39787347 CCCTTGAGGGGGCCCTCCGATGC 0: 1
1: 8
2: 6
3: 16
4: 47
Right 1189276123 X:39787360-39787382 CTTCTTGGTGTCATCATATTTGG 0: 2
1: 11
2: 17
3: 32
4: 199
1189276114_1189276124 16 Left 1189276114 X:39787325-39787347 CCCTTGAGGGGGCCCTCCGATGC 0: 1
1: 8
2: 6
3: 16
4: 47
Right 1189276124 X:39787364-39787386 TTGGTGTCATCATATTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189276114 Original CRISPR GCATCGGAGGGCCCCCTCAA GGG (reversed) Intergenic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
903287625 1:22286628-22286650 CCAACTGAGGGCCCCCTCACTGG - Intergenic
904553291 1:31339596-31339618 GCATTGGAGTGCTCCATCAATGG + Intronic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
907514725 1:54986356-54986378 GCATCCCAGGGCCACCTCGATGG + Exonic
908375432 1:63533554-63533576 ACATCGAAGGGTCCCCTGAAAGG + Exonic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
911044809 1:93619629-93619651 GCATGGGAGGGACCTCTGAAGGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913499865 1:119462222-119462244 ACATCAGAGGATCCCCTCAAGGG - Intergenic
913503669 1:119496029-119496051 GAATTGGAAGGCTCCCTCAAGGG - Intergenic
913507767 1:119533943-119533965 GCATCGGAGTTCCCCTTCGAGGG - Intergenic
913510688 1:119558944-119558966 GCATCAGAGGGTCCCCATAAGGG - Intergenic
913514906 1:119596360-119596382 GCATCAGAAGGCCCCCATAAGGG - Intergenic
924207210 1:241725597-241725619 GCCTGGGAGGAACCCCTCAAAGG - Intronic
1067214974 10:44293833-44293855 CCACCTGAGGGCCCCCTGAAAGG + Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1077595893 11:3531416-3531438 TCATGGGAGGGCCCCCCCATGGG - Intergenic
1078665352 11:13320369-13320391 GAAGCTGAGGGCACCCTCAAAGG - Intronic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1089074660 11:115728619-115728641 GCATCGCAGCTCCCCCTCCATGG + Intergenic
1090199369 11:124843320-124843342 CCTTCGGAGGACCCCCTCCAGGG - Intergenic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1094855235 12:34399949-34399971 GCATCAGAGGTCCCCTGCAACGG + Intergenic
1103535776 12:121633038-121633060 GCATGGGAGGGCTGCCTCAGAGG + Intronic
1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG + Intergenic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1114443181 14:22767255-22767277 GCGTCGCAGGGCCCTCGCAATGG + Exonic
1115444127 14:33469946-33469968 GCATCAGGGGGCCAGCTCAAGGG + Intronic
1118972446 14:70648484-70648506 ACATGGGAGTGCCCCCTCCAAGG + Intronic
1126187541 15:45845162-45845184 CCATCGGACAGCCCCCACAAAGG - Intergenic
1132564488 16:615196-615218 GCATCGAAGGACACCATCAATGG - Intronic
1144862533 17:18314683-18314705 GCCTCGGAGGGCCATCTCCATGG + Exonic
1146938643 17:36828200-36828222 GCATGGGAGGGCCACCTAAGGGG + Intergenic
1151745146 17:76007940-76007962 GCAGCGGAGGGCGGCCTCGATGG + Exonic
1164879018 19:31715186-31715208 GCATCGGTGGAACCCCTCAAAGG - Intergenic
1166679859 19:44759548-44759570 GCCTCGGAGGACCCCAGCAAAGG - Exonic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
926891011 2:17638853-17638875 GCATAGGAGGGCCCCTTCCCAGG + Intronic
932416018 2:71574355-71574377 ACATACCAGGGCCCCCTCAAGGG - Exonic
938473718 2:131589403-131589425 GCATCCCAGGGCACCCTCAGTGG - Intergenic
948787646 2:240361139-240361161 GCATCTGAAGGCGCCCTCCACGG + Intergenic
1168889338 20:1284117-1284139 GCACCAGAGGGTCCCCTCTAAGG - Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170978288 20:21187369-21187391 TCATCTGAGTGCCCCCTCAGTGG + Intronic
1175585788 20:60138690-60138712 GGATCGGAGCGGCCGCTCAAAGG + Intergenic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1184101753 22:42344556-42344578 GCATCGCAGGTCCCCCTCTGTGG + Intergenic
951682760 3:25311607-25311629 GCAGCTGAGGGCTTCCTCAAAGG + Intronic
963292196 3:143503461-143503483 GCTTTGGAGGGTCCCCTCAAGGG - Intronic
968801471 4:2745974-2745996 GCAGCTGGGGGCCCCCTCACTGG - Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
979642351 4:123023899-123023921 GCCTCGGAGGGCCCCCAGAACGG - Intronic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
1000300312 5:159950686-159950708 GCATTGGAGTGTCCCCCCAAGGG - Intronic
1001389235 5:171365531-171365553 GCGTCGTATGGCCCCCTCTATGG - Intergenic
1001984575 5:176061961-176061983 GCCTCGGAGGGCACCCTCAGAGG + Exonic
1002232940 5:177782236-177782258 GCCTCAGAGGGCACCCTCAGAGG - Exonic
1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG + Intronic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1006393652 6:33773282-33773304 ACAACGGAGGGCCCCTTCAGTGG + Intronic
1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1024095506 7:45979486-45979508 GCATCTGTGGTCCTCCTCAAGGG + Intergenic
1029988769 7:104944313-104944335 CCATCTGGGGACCCCCTCAAAGG + Intergenic
1049358900 8:142202497-142202519 GCAGGGCAGGGCCCCCTCCATGG + Intergenic
1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG + Intronic
1061307955 9:129743236-129743258 GCCTCGGAGGGGCCCCTCTGCGG - Intronic
1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1189973394 X:46439899-46439921 GCGTTGAAGGCCCCCCTCAAGGG - Intergenic