ID: 1189276114

View in Genome Browser
Species Human (GRCh38)
Location X:39787325-39787347
Sequence GCATCGGAGGGCCCCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 8, 2: 6, 3: 16, 4: 47}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189276114_1189276125 29 Left 1189276114 X:39787325-39787347 CCCTTGAGGGGGCCCTCCGATGC 0: 1
1: 8
2: 6
3: 16
4: 47
Right 1189276125 X:39787377-39787399 ATTTGGCAGGTTTTTCCAGACGG No data
1189276114_1189276123 12 Left 1189276114 X:39787325-39787347 CCCTTGAGGGGGCCCTCCGATGC 0: 1
1: 8
2: 6
3: 16
4: 47
Right 1189276123 X:39787360-39787382 CTTCTTGGTGTCATCATATTTGG No data
1189276114_1189276119 -3 Left 1189276114 X:39787325-39787347 CCCTTGAGGGGGCCCTCCGATGC 0: 1
1: 8
2: 6
3: 16
4: 47
Right 1189276119 X:39787345-39787367 TGCCTGCTTCACCACCTTCTTGG 0: 1
1: 2
2: 1
3: 37
4: 275
1189276114_1189276124 16 Left 1189276114 X:39787325-39787347 CCCTTGAGGGGGCCCTCCGATGC 0: 1
1: 8
2: 6
3: 16
4: 47
Right 1189276124 X:39787364-39787386 TTGGTGTCATCATATTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189276114 Original CRISPR GCATCGGAGGGCCCCCTCAA GGG (reversed) Intergenic