ID: 1189276119

View in Genome Browser
Species Human (GRCh38)
Location X:39787345-39787367
Sequence TGCCTGCTTCACCACCTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 2, 2: 1, 3: 37, 4: 275}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189276106_1189276119 23 Left 1189276106 X:39787299-39787321 CCTGGTGCTCAGTGTAGCCCAGG No data
Right 1189276119 X:39787345-39787367 TGCCTGCTTCACCACCTTCTTGG 0: 1
1: 2
2: 1
3: 37
4: 275
1189276112_1189276119 6 Left 1189276112 X:39787316-39787338 CCCAGGATGCCCTTGAGGGGGCC No data
Right 1189276119 X:39787345-39787367 TGCCTGCTTCACCACCTTCTTGG 0: 1
1: 2
2: 1
3: 37
4: 275
1189276113_1189276119 5 Left 1189276113 X:39787317-39787339 CCAGGATGCCCTTGAGGGGGCCC No data
Right 1189276119 X:39787345-39787367 TGCCTGCTTCACCACCTTCTTGG 0: 1
1: 2
2: 1
3: 37
4: 275
1189276105_1189276119 26 Left 1189276105 X:39787296-39787318 CCACCTGGTGCTCAGTGTAGCCC No data
Right 1189276119 X:39787345-39787367 TGCCTGCTTCACCACCTTCTTGG 0: 1
1: 2
2: 1
3: 37
4: 275
1189276115_1189276119 -4 Left 1189276115 X:39787326-39787348 CCTTGAGGGGGCCCTCCGATGCC No data
Right 1189276119 X:39787345-39787367 TGCCTGCTTCACCACCTTCTTGG 0: 1
1: 2
2: 1
3: 37
4: 275
1189276114_1189276119 -3 Left 1189276114 X:39787325-39787347 CCCTTGAGGGGGCCCTCCGATGC 0: 1
1: 8
2: 6
3: 16
4: 47
Right 1189276119 X:39787345-39787367 TGCCTGCTTCACCACCTTCTTGG 0: 1
1: 2
2: 1
3: 37
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189276119 Original CRISPR TGCCTGCTTCACCACCTTCT TGG Intergenic