ID: 1189276119

View in Genome Browser
Species Human (GRCh38)
Location X:39787345-39787367
Sequence TGCCTGCTTCACCACCTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 2, 2: 1, 3: 37, 4: 275}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189276112_1189276119 6 Left 1189276112 X:39787316-39787338 CCCAGGATGCCCTTGAGGGGGCC No data
Right 1189276119 X:39787345-39787367 TGCCTGCTTCACCACCTTCTTGG 0: 1
1: 2
2: 1
3: 37
4: 275
1189276113_1189276119 5 Left 1189276113 X:39787317-39787339 CCAGGATGCCCTTGAGGGGGCCC 0: 8
1: 10
2: 12
3: 20
4: 150
Right 1189276119 X:39787345-39787367 TGCCTGCTTCACCACCTTCTTGG 0: 1
1: 2
2: 1
3: 37
4: 275
1189276106_1189276119 23 Left 1189276106 X:39787299-39787321 CCTGGTGCTCAGTGTAGCCCAGG 0: 7
1: 12
2: 10
3: 36
4: 260
Right 1189276119 X:39787345-39787367 TGCCTGCTTCACCACCTTCTTGG 0: 1
1: 2
2: 1
3: 37
4: 275
1189276114_1189276119 -3 Left 1189276114 X:39787325-39787347 CCCTTGAGGGGGCCCTCCGATGC 0: 1
1: 8
2: 6
3: 16
4: 47
Right 1189276119 X:39787345-39787367 TGCCTGCTTCACCACCTTCTTGG 0: 1
1: 2
2: 1
3: 37
4: 275
1189276105_1189276119 26 Left 1189276105 X:39787296-39787318 CCACCTGGTGCTCAGTGTAGCCC No data
Right 1189276119 X:39787345-39787367 TGCCTGCTTCACCACCTTCTTGG 0: 1
1: 2
2: 1
3: 37
4: 275
1189276115_1189276119 -4 Left 1189276115 X:39787326-39787348 CCTTGAGGGGGCCCTCCGATGCC No data
Right 1189276119 X:39787345-39787367 TGCCTGCTTCACCACCTTCTTGG 0: 1
1: 2
2: 1
3: 37
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189276119 Original CRISPR TGCCTGCTTCACCACCTTCT TGG Intergenic
900319935 1:2078078-2078100 TGCCTGCCTCACCTCCCTCCTGG + Intronic
900580082 1:3404519-3404541 TGCCGGCTTCCCCATCTGCTAGG + Intronic
901011208 1:6203423-6203445 TACCAGCTCCACCACTTTCTGGG + Intronic
901049333 1:6418648-6418670 TCCCTGCTTCACCCCCAACTTGG - Exonic
901192451 1:7420735-7420757 TGTCTGCTTCTCCACCAGCTTGG - Intronic
901746066 1:11374567-11374589 TGCCTGTTTCAGCGCCTGCTTGG + Intergenic
903758269 1:25679150-25679172 TGCCCGCTTCTCCCACTTCTGGG - Intronic
905956839 1:42004113-42004135 GGCCTGCTCCACCACCTGGTTGG - Intronic
907124979 1:52041724-52041746 TCCCAGCTCCACCACCTTCTAGG + Intronic
907241163 1:53081854-53081876 CGCCTGCTGCACCACTTTCCGGG + Intronic
907372037 1:54010012-54010034 TCCTTGCATGACCACCTTCTGGG + Intronic
908956350 1:69633552-69633574 TGCCTGTTATACCACCTACTTGG - Intronic
911642631 1:100305209-100305231 TACCAGCTTCACCACTTTTTAGG + Intergenic
912518936 1:110232347-110232369 AGCCTTCTTCACCAGCTCCTTGG + Exonic
915111216 1:153565702-153565724 TGCCAGCTCCACCACCAGCTGGG + Exonic
916344426 1:163771780-163771802 TGCCTGCTTTTCCACTTTCATGG - Intergenic
917137767 1:171803919-171803941 TTCCTGCTTCACCACCCTCAAGG + Intronic
917174851 1:172222436-172222458 TGGCCTCTTCACCAACTTCTTGG - Intronic
918504099 1:185232750-185232772 TGCATACTATACCACCTTCTGGG + Intronic
918976772 1:191498451-191498473 TTGCTGCATCACCTCCTTCTTGG - Intergenic
919018716 1:192075560-192075582 CGCCTGGTGCACCACCTTCCAGG - Intergenic
920238872 1:204529272-204529294 AGCCTGCTTCACCTCCTTCATGG + Intronic
921381795 1:214532325-214532347 GTCCTGCTACACCAGCTTCTGGG + Intronic
921414620 1:214871488-214871510 TGCCTGCTTCACCACCTTGTTGG - Intergenic
922588323 1:226752685-226752707 TGCCTGCTTCCCCAGCCTCCGGG - Intergenic
923920544 1:238559669-238559691 TGTCTGCTTCAGCACCACCTGGG - Intergenic
924262862 1:242250040-242250062 TTATTCCTTCACCACCTTCTAGG + Intronic
1063674018 10:8123751-8123773 TGCCTAAATGACCACCTTCTTGG - Intergenic
1063845585 10:10123877-10123899 TCCCTCCTTTACCACATTCTGGG + Intergenic
1063996146 10:11621872-11621894 TGCCTGTTTCACCACATTTTGGG - Intergenic
1064790824 10:18956198-18956220 TGTCTGGGTCTCCACCTTCTGGG + Intergenic
1065381696 10:25097112-25097134 TGCCTCCTTCTCCACATCCTTGG + Intergenic
1067200501 10:44167684-44167706 TGCCTGCATCAGGACCCTCTGGG + Intergenic
1067574279 10:47398565-47398587 TGCCTCCTTCTCCTCCTTCTGGG + Intergenic
1070191238 10:74113771-74113793 TGCCTGTTTAACCAGCTCCTTGG + Intronic
1070427278 10:76301508-76301530 TGCTTGCTTCATCACGTTTTAGG + Intronic
1071128977 10:82369954-82369976 TGCATGCTTCCCCTCCTTCAGGG - Intronic
1073192693 10:101663010-101663032 TGCCTTATTCACCAGCATCTTGG - Intronic
1073353659 10:102837019-102837041 TGCCCCCTTCACCACCCCCTGGG - Intronic
1074261382 10:111856850-111856872 TGTCTGGTTCTCCTCCTTCTGGG + Intergenic
1074820433 10:117174390-117174412 TGACTGCTGCATCTCCTTCTAGG + Intergenic
1075509833 10:123062947-123062969 TGTCTGCTCTACCCCCTTCTTGG + Intergenic
1076217054 10:128703590-128703612 TGCCTGCTTCAGCACCTCTTTGG + Intergenic
1076644002 10:131938993-131939015 TGGCTGCTTCTGCACCATCTGGG - Intronic
1077354690 11:2109699-2109721 TGGCTGCAGCGCCACCTTCTAGG - Intergenic
1077875739 11:6303514-6303536 TCCCCTCTTGACCACCTTCTGGG + Intergenic
1078191314 11:9094174-9094196 TGCCTTCTCCACCATCTTCTAGG + Intronic
1078545304 11:12242583-12242605 TGCCTCCCTCACCCACTTCTTGG + Intronic
1078612019 11:12829133-12829155 TGCCTGCTGCACTTCCGTCTTGG - Intronic
1079237450 11:18700464-18700486 TGCCTGCTTTCCCACATTCCTGG + Intronic
1080639380 11:34149900-34149922 AGCCCGCTCCACCACCGTCTTGG + Intergenic
1080650041 11:34215027-34215049 TGCCTGAGTCACCACCACCTGGG - Intronic
1082838239 11:57667443-57667465 TTCCTGCTTCAGCCCCTTCGCGG - Intergenic
1083946259 11:65924728-65924750 TGCCTCCTTCCCCAGCCTCTGGG - Intergenic
1084772115 11:71350001-71350023 AGCCCGCTTCACCAGCTTCTAGG - Intergenic
1085617347 11:78011084-78011106 TGCCTCCTTCACCAACTCCAGGG - Intergenic
1087151869 11:94866944-94866966 TGCCTGCTTCCCCTCCAGCTTGG - Intronic
1087292703 11:96337940-96337962 TGCCTGCTGGATCACCATCTGGG - Intronic
1087828876 11:102797336-102797358 GGGCTGCTTCATCACCTTCAGGG + Exonic
1087886068 11:103484325-103484347 TGCCTGCAACACTACCATCTTGG + Intergenic
1088425151 11:109693891-109693913 AGGCTGCTTCCCCAGCTTCTAGG - Intergenic
1088859397 11:113785669-113785691 TGCCTTCTTCACCACCCATTTGG - Intergenic
1088939363 11:114438120-114438142 TGCCTGCTCTGCCATCTTCTTGG - Intronic
1089007879 11:115107776-115107798 TGCCTGCTTCACCCTCTGGTTGG - Intergenic
1089613287 11:119681456-119681478 TGCCTGCCTCCACACCTTCAGGG - Intronic
1090470524 11:126977119-126977141 TGCAGGCTTCAGCTCCTTCTGGG + Intronic
1091092880 11:132789277-132789299 TGCCTTGTTCACCACTGTCTAGG + Intronic
1091568874 12:1667337-1667359 TGCCTGGGTCACTACCTACTTGG - Intergenic
1091785958 12:3243611-3243633 TGGCTGCTTCTCCACCTCATCGG - Intronic
1091862004 12:3793988-3794010 TGCTAGCTTCACCCACTTCTAGG - Intronic
1092301979 12:7259991-7260013 TTCCTGCTTCATCTCTTTCTTGG - Intergenic
1093205283 12:16241255-16241277 TCCCTGCTTCACCACCATCCTGG + Intronic
1093896878 12:24583972-24583994 TGGCTGCTTTACCTTCTTCTTGG - Intergenic
1097106866 12:56630803-56630825 TGCCTGGATCACCACTTTCCTGG + Intronic
1102132059 12:110539496-110539518 TGCCTGATTCAACACCTGCTGGG + Intronic
1103335096 12:120183492-120183514 AGCATGTTTCAGCACCTTCTTGG - Intronic
1103733295 12:123042737-123042759 TGCCTGCTTCAGCTCCTGATTGG - Intronic
1104341423 12:127953159-127953181 TTCCTGTTTCTCCACCTCCTCGG - Intergenic
1105308235 13:19183903-19183925 AGCCTGCTTGGCCACCCTCTAGG - Intronic
1105791494 13:23804392-23804414 TGCCTGATTCACCTGCTTTTGGG - Intronic
1106029124 13:25983891-25983913 CCCCTGCTTCACTACCTGCTTGG - Intronic
1107772712 13:43806032-43806054 TGCCTGCTTCACAGTCTTCTGGG - Intergenic
1112381835 13:98898235-98898257 GGCATTCTTCAGCACCTTCTGGG + Exonic
1114325879 14:21588266-21588288 AACCTGCTTCCCCACCATCTTGG + Intergenic
1114597540 14:23926234-23926256 TGCCTGCCTCTCCTCCTCCTGGG + Intergenic
1114645719 14:24254982-24255004 TGCCAGCTCCACTTCCTTCTTGG + Exonic
1114942396 14:27630068-27630090 TGCCTCCTTCTTCAGCTTCTTGG + Intergenic
1118722051 14:68601320-68601342 TGCCTGGCTCACCTCCTTCCTGG + Intronic
1118839937 14:69502465-69502487 TGCCTGCTTCAGAACTTCCTAGG + Intronic
1118910827 14:70060580-70060602 TTCCTCCTTTACCGCCTTCTGGG - Intronic
1120093246 14:80358671-80358693 TGCTTCCTTTACCACCTTCTTGG + Intronic
1121100232 14:91245239-91245261 TACCTGCTTCACCACATCCGTGG - Intronic
1121429694 14:93878220-93878242 TGCCTTTATCACCACCTACTCGG - Intergenic
1121918471 14:97857867-97857889 TGCCAGCTTCATCTCCTCCTGGG - Intergenic
1123203423 14:106690551-106690573 TGCCTTCCTCACCCCTTTCTAGG - Intergenic
1127367095 15:58301232-58301254 TGCCTACTTCACCACGGTTTTGG + Intronic
1129422755 15:75442431-75442453 TGCCTGCAATCCCACCTTCTTGG - Intronic
1129474773 15:75777572-75777594 ATCCTGCTTCTCCATCTTCTAGG + Intergenic
1129832513 15:78679859-78679881 TGCATCCTGCCCCACCTTCTTGG - Intronic
1132465682 16:76455-76477 TGCCGGCCTCTCCACCTCCTGGG + Intergenic
1132852361 16:2030480-2030502 GGCCTGCTCCACCTCCTGCTAGG + Intronic
1134219833 16:12345214-12345236 TGCATGCTACACCTTCTTCTGGG + Intronic
1135588393 16:23688684-23688706 TGCCTGCATCCCCATCTTCTGGG + Exonic
1137019105 16:35405986-35406008 AGCCTGCTTCACCAACACCTGGG + Intergenic
1137880931 16:52047565-52047587 TTCCAGCTTCACCTCTTTCTGGG - Intronic
1139047204 16:63076251-63076273 AACCAGCTTCACCACCATCTGGG - Intergenic
1139581943 16:67879001-67879023 CGCCTGCTTCAGCTCCATCTCGG + Exonic
1140495921 16:75388271-75388293 TGGCTGCTTCACCACATTTAAGG - Intronic
1141490516 16:84369236-84369258 TGCCTGCTTTGCAACCTTCAGGG + Intronic
1142110455 16:88328386-88328408 TGCCTTCTTCACAACCTCCAGGG + Intergenic
1143236552 17:5406596-5406618 TGCCTACTTCACCATCTGCCTGG - Intronic
1143918315 17:10311139-10311161 TTCCTGCTCCACTAGCTTCTTGG + Exonic
1144827734 17:18115797-18115819 TGTCTGCTCCTCCACCTGCTTGG + Intronic
1145233447 17:21191710-21191732 TGCCTGCTTTAGCACCTCATAGG + Exonic
1145235929 17:21208441-21208463 TTCCTGCTCCAGAACCTTCTCGG + Intronic
1145871498 17:28277172-28277194 GTCCTGCTTCACCAGCTTCCAGG - Intergenic
1145990293 17:29075258-29075280 TGCCTGCTTCAGAGCCTTCTGGG - Exonic
1146194983 17:30803886-30803908 TCCCTGGTCCCCCACCTTCTCGG + Exonic
1146305406 17:31726294-31726316 TGCCTGCTTTACAGGCTTCTGGG - Intergenic
1147217787 17:38911142-38911164 TGGCTCCTTCACTACCTTCCAGG + Intronic
1147636063 17:41965059-41965081 CCACTGCTTCACCACCTTCTCGG - Exonic
1147959513 17:44157931-44157953 TGACTGCTTTACCTGCTTCTGGG - Exonic
1148403473 17:47388229-47388251 AGCCAGCTTCCCCACCATCTTGG - Intronic
1150155762 17:62851744-62851766 TGCCTTCTTCATCTTCTTCTTGG + Intergenic
1150226690 17:63528296-63528318 TGCCTGCTTCACCCACTCCTGGG - Intronic
1150227170 17:63530493-63530515 TGTCCGCTCCACCACCTTATGGG - Exonic
1150616561 17:66776924-66776946 TAACTGGTACACCACCTTCTAGG - Intronic
1151213659 17:72562849-72562871 TGCAAGCATCACCACCATCTAGG + Intergenic
1151745611 17:76010193-76010215 TTCCAGCTGCACGACCTTCTGGG + Exonic
1151812710 17:76453751-76453773 GGCCTCCTTCACCAGCTTCTGGG - Exonic
1152360451 17:79830935-79830957 TGGCTGCTCCACCACCTGCAGGG - Intergenic
1152922595 17:83073373-83073395 CGCCTGCTTCTCCTCGTTCTGGG + Intergenic
1155969121 18:32064642-32064664 TGCCTGCTATCCCACCTACTTGG - Intronic
1157090238 18:44628092-44628114 TGCCTGCTACACCATCTGTTGGG - Intergenic
1157934368 18:51857170-51857192 TTCCTGCATCACCACCTACGTGG - Intergenic
1158905709 18:62009568-62009590 TGCTTCCTGCACCACCTTCCTGG - Intergenic
1159244695 18:65790334-65790356 TGCATGCTTCACCATCAACTAGG - Intronic
1160451193 18:78966910-78966932 TGCCTGCTGTACAACCCTCTGGG - Intergenic
1160726403 19:619673-619695 CGTCTGCTTCACCACCTTGCGGG + Exonic
1161206106 19:3042131-3042153 TCCCTCCTACACCCCCTTCTCGG - Intronic
1163219307 19:15903033-15903055 TGTCTGCTTCACCACCTTGCGGG + Intergenic
1163986784 19:20961235-20961257 GTCCTGCTTCACCAGCTTCAAGG + Intergenic
1166558971 19:43719505-43719527 TGCCTGTTTGCCCACCTGCTCGG - Exonic
1168096505 19:54118503-54118525 AGCCTGTATCACCCCCTTCTGGG - Intronic
1168711056 19:58500176-58500198 GGCCTGCCTTACCACCATCTGGG - Intronic
925200751 2:1965963-1965985 TGCCTGCTTCACGACGCCCTAGG + Intronic
925803419 2:7625137-7625159 TGCCTCCTGTACCTCCTTCTTGG - Intergenic
927794840 2:26038844-26038866 TGCAAGCTCCGCCACCTTCTGGG - Intronic
928171423 2:29007006-29007028 TACCTGCTTCTCGACCTTCCAGG + Intronic
928673361 2:33625624-33625646 GGCCTGTTTCACCAGCTTCGGGG + Intergenic
929704406 2:44195327-44195349 TGCCTGCAGCACCAGCTACTTGG - Intronic
933205338 2:79500944-79500966 TGGCTGCTTCATCAAGTTCTTGG - Intronic
934969960 2:98755200-98755222 TGAATGCTTCACCCCCTTGTTGG + Intergenic
935943420 2:108265143-108265165 TGCCTGTTTCTCCTCATTCTTGG + Intronic
935972386 2:108542805-108542827 TGGCTGCTTCAACACCTATTAGG + Intronic
937003676 2:118491492-118491514 TGCCTGCATTTCCACATTCTTGG + Intergenic
937889240 2:126924209-126924231 TGCCTTCTTGACTCCCTTCTCGG + Intergenic
938104919 2:128523424-128523446 TGCCTACTTTCCCACCTTCCAGG - Intergenic
938986674 2:136583228-136583250 TGCCTGCTTAACCCACTCCTGGG - Intergenic
941280773 2:163548008-163548030 TGCCTGGATAACCACCTACTAGG + Intergenic
941589881 2:167406576-167406598 AGCCGGCTTCCCCACCTTCTTGG + Intergenic
942356407 2:175116733-175116755 TGGCTGCTTCAGCATCTTTTAGG - Intronic
943568109 2:189540692-189540714 AGACTGGTTCACCAGCTTCTTGG + Intergenic
946148716 2:217749727-217749749 TGCCAGCTTCACCAGAGTCTGGG + Intronic
946253813 2:218429439-218429461 TGCCGGCTCCACCACCGTGTCGG - Exonic
946489371 2:220132919-220132941 TGCCTGCTGTACTACCCTCTTGG + Intergenic
947837222 2:233184527-233184549 TGGCTGCTGAGCCACCTTCTGGG + Intronic
947987461 2:234461150-234461172 TGCCCGCTTCAGCTCCTTCTAGG - Intergenic
1168894194 20:1312622-1312644 TGCCTTCTTCACCACCTGATGGG + Exonic
1169271913 20:4206854-4206876 TGCCTGCCTCAGCAACTTTTTGG + Intergenic
1169494080 20:6096910-6096932 TGTCCGCTTTTCCACCTTCTAGG + Exonic
1169655114 20:7914268-7914290 TGCCTGCCGCACTAGCTTCTTGG + Exonic
1171029175 20:21661752-21661774 TGCCTGCTCCGCACCCTTCTTGG - Intergenic
1171419017 20:25005317-25005339 TTCCTCCTTCTCCAGCTTCTAGG - Intergenic
1171949159 20:31405568-31405590 TGCCTTCTTCACAACATCCTGGG + Intronic
1172642545 20:36449481-36449503 TGCCAGCCTCTCCACCTTCAAGG + Intronic
1173643871 20:44621778-44621800 TTCTTGCTCCACCACCTCCTGGG + Intronic
1173710284 20:45149660-45149682 TGCCTACTTCCCTGCCTTCTTGG + Intergenic
1173729538 20:45318718-45318740 TGCCTGCTTCAACACCACCATGG - Intergenic
1175546710 20:59782851-59782873 TGCCCGTGTCACCACATTCTTGG - Intronic
1176105052 20:63381994-63382016 TCCCTGCAGCACCACCTGCTGGG + Intergenic
1176874511 21:14114998-14115020 TTCCTTCTTCACCACCATGTTGG - Intronic
1176903159 21:14468066-14468088 TCCCTGCTTCACCACCCTGCTGG + Intergenic
1177854555 21:26386564-26386586 TGTGTGCTACACCAGCTTCTGGG + Intergenic
1178380128 21:32100692-32100714 GGCCTGCTGCACCTCCTCCTGGG + Intergenic
1180140815 21:45892564-45892586 TGCCTGCTTCCCCTCCTCCCAGG - Intronic
1180963412 22:19773239-19773261 TGCCTGCTCCGCCACCTCCTGGG + Intronic
1181476121 22:23168765-23168787 TGCCTGCTCCCTCACCTTCCTGG - Intergenic
1181910147 22:26232019-26232041 TGCAAGCTCCACCACCTACTTGG + Intronic
1181925496 22:26355400-26355422 TGTCTGCTTCATTAACTTCTTGG - Intronic
1182395026 22:30029061-30029083 CACCTGCTTCACCAGCATCTTGG - Intronic
1182395660 22:30034064-30034086 TCCCTGCTGCACCAACATCTTGG + Intergenic
1183398903 22:37589483-37589505 TGCCTGCTCCGGCACCTTCATGG + Intergenic
1183705655 22:39473720-39473742 TGCCACCTGCACCACCTCCTTGG - Intronic
949562276 3:5213888-5213910 TGCCTGCTGGAGCATCTTCTTGG + Intronic
949948490 3:9209122-9209144 TACCTTCCTCACCTCCTTCTGGG + Intronic
950210601 3:11120318-11120340 TTCCTGCTCCACCACATTCTTGG - Intergenic
950303318 3:11900078-11900100 GGCCTGCACCACCGCCTTCTGGG - Intergenic
950891094 3:16405116-16405138 TGCCTGCTTTACAATCCTCTGGG + Intronic
951766193 3:26202347-26202369 TGCCCGCTTCAGCCCCTACTGGG + Intergenic
951911261 3:27753121-27753143 TGCTTTCTTCATCACCATCTTGG - Intergenic
954405537 3:50343189-50343211 TGCCTGCTTCTGCAGCTCCTGGG + Exonic
955395259 3:58552643-58552665 AGCCAGCTTCCCCACCATCTTGG - Intergenic
959597465 3:108143809-108143831 TCCCTGCATCTCCACCTTCTGGG + Intergenic
959632949 3:108529611-108529633 TCCCTGTTTCCCCACCTTGTTGG - Intergenic
960474410 3:118106818-118106840 TCCCTGCTTCACCATTTTCTTGG + Intergenic
962683102 3:137820755-137820777 TGCCAGCTTCATCCCCTTCTAGG + Intergenic
963361005 3:144271809-144271831 TGCCTGCTTGTTCACCTTTTGGG + Intergenic
965485759 3:169276425-169276447 TGCCTGTTTTCCCACCTACTCGG + Intronic
966464308 3:180212880-180212902 TGTCTGCTTCATCACCTTCTTGG - Intergenic
966571931 3:181453640-181453662 TGCCAGCTTCCCCACCACCTTGG + Intergenic
967047947 3:185754998-185755020 TGGCTGCTCCACAACCTACTTGG - Intronic
967145564 3:186603118-186603140 TGCCTGCTTCTCCACCTTGCAGG + Intergenic
972517387 4:39820925-39820947 TGCCTGTTTTCCCAGCTTCTCGG - Intergenic
973167560 4:47096290-47096312 GGCCTGCCTCACTACCTACTTGG - Intronic
974980199 4:68946540-68946562 TGCCTGCATTACCAACTTGTAGG + Intronic
975656216 4:76643476-76643498 TGCCTGCTTCAGCAGGTTCATGG + Intronic
976129454 4:81869568-81869590 TGCCTCCTCCTCCTCCTTCTTGG + Intronic
982018444 4:151179390-151179412 TTCCTTCTTCAACAGCTTCTCGG - Exonic
982324868 4:154119881-154119903 TGTCTGTTTCACGACTTTCTGGG - Intergenic
982537366 4:156623467-156623489 TCTCTGCTTCAGCAACTTCTAGG + Intergenic
982725933 4:158906377-158906399 TCCCTCATTCACCACCTTCCAGG + Exonic
983256953 4:165410519-165410541 TTTCTACTTCAGCACCTTCTGGG - Intronic
983543986 4:168942978-168943000 TTCCTGTTTCTCTACCTTCTTGG - Intronic
984593755 4:181644578-181644600 TGCCTGCCTCACCAAATTCAGGG + Intergenic
985535814 5:465214-465236 TGCCTCCCTAACCATCTTCTCGG - Exonic
985799359 5:1994173-1994195 TGTCTGAATCCCCACCTTCTTGG - Intergenic
985799439 5:1994685-1994707 TGTCTGAATCCCCACCTTCTTGG - Intergenic
986912832 5:12577851-12577873 TACATCCTTCACCACATTCTTGG - Intergenic
990373046 5:55140360-55140382 AGCCTGCTGAACCACGTTCTGGG + Exonic
991297490 5:65096890-65096912 TGCCTGCTGTCCCAGCTTCTTGG + Intergenic
991488679 5:67163780-67163802 TGCTTTCTTCACCACCACCTTGG - Exonic
992186043 5:74245599-74245621 TGCATGCTTCATCTCCTGCTTGG + Intergenic
992213907 5:74507156-74507178 GGCCTGCTTCAGAACATTCTTGG - Intergenic
992252879 5:74893426-74893448 TGTCTACTTTGCCACCTTCTTGG + Intergenic
994680471 5:102880153-102880175 TGCCTGCTTTCCCAGCTACTTGG + Intronic
997669269 5:135657020-135657042 TGCCTGCCCCTCCACCCTCTGGG + Intergenic
998893236 5:146769001-146769023 TACCTGCTTTCCCACCTACTTGG - Intronic
1000023999 5:157343152-157343174 GGCCTGCTTCACAGCCGTCTTGG - Exonic
1001975711 5:175996876-175996898 TCCCTGCTTCTCCCACTTCTGGG - Intronic
1002056635 5:176601613-176601635 TGCCTGCTGGACCCTCTTCTTGG - Intronic
1002241717 5:177846896-177846918 TCCCTGCTTCTCCCACTTCTGGG + Intergenic
1003101309 6:3178487-3178509 TGCCTGTATCCCCACCTACTCGG - Intergenic
1004230846 6:13831688-13831710 TGCATGCTTCTCCATCTTCTAGG + Intergenic
1004314192 6:14571886-14571908 TGCCTGCTGCTCCACTTCCTCGG + Intergenic
1005328731 6:24727910-24727932 TATCTGCTTCACCACCTCTTTGG - Intergenic
1005396684 6:25389439-25389461 TGCCTGTATCCCCAGCTTCTTGG - Intronic
1005483059 6:26273019-26273041 TGCCTTGGTCACCGCCTTCTTGG - Exonic
1005643205 6:27816224-27816246 TGCCTGTAACACCAGCTTCTCGG + Intergenic
1005685756 6:28251888-28251910 TTCCTCCTTCTCCACCTTCACGG + Exonic
1006903137 6:37515903-37515925 GGCCTGCTTCCCCAGCTGCTGGG + Intergenic
1007083408 6:39125343-39125365 CGCCTGCTTAGCCACCTCCTTGG + Intergenic
1007261934 6:40569963-40569985 TGCCAGCTGCACCATGTTCTTGG + Intronic
1007414795 6:41684983-41685005 CTCCTGCTTCACCACCTGCTGGG + Exonic
1008270731 6:49486327-49486349 TGGCTGCTGTACCACCTACTTGG - Intronic
1009023226 6:57967900-57967922 TGCCTCCTTCATTACCTTCTTGG + Intergenic
1009198794 6:60719434-60719456 TGCCTCCTTCATTACCTTCTTGG + Intergenic
1010494159 6:76513510-76513532 TGCATGCTCCACCTCCTTCAAGG - Intergenic
1011071807 6:83393175-83393197 CGCCTGCTTCACCACCTTCTTGG - Intronic
1012416020 6:99014801-99014823 TTCCTGTGTCACCAGCTTCTAGG + Intergenic
1014760327 6:125349099-125349121 TGTCTACTTCACCAACATCTAGG + Intergenic
1015970844 6:138741426-138741448 TACCTGGTTCACCTCCTACTTGG + Intergenic
1017570502 6:155739402-155739424 TCCCTGGTTCTCCACTTTCTAGG - Intergenic
1017577746 6:155823929-155823951 AGACTGCATCACCACCCTCTAGG + Intergenic
1017825728 6:158080708-158080730 TGTCTGCTTCCCCACCTCCTTGG + Intronic
1018748587 6:166781767-166781789 TGCCTGCTTCTCCATCTGCCTGG - Intronic
1018756945 6:166858129-166858151 TTCCCCCTTCACCACCTTCTGGG + Exonic
1019716304 7:2541027-2541049 CGCCTGCGTCACCAGCTCCTGGG + Exonic
1021659738 7:22908016-22908038 TGCCTGCATGAGAACCTTCTGGG - Intergenic
1022446701 7:30476969-30476991 TGCCAGCGCCACCACCTTCCAGG + Intronic
1024280005 7:47710780-47710802 TGCCTGCTTCTCATCCTCCTGGG - Intronic
1024585274 7:50836601-50836623 TGCCAGCTTCAGCACATTCCAGG - Intergenic
1024666415 7:51551312-51551334 TGCCTGTTTCCCCAGCCTCTTGG + Intergenic
1024944167 7:54792421-54792443 TGCCTGGCTGCCCACCTTCTGGG - Intergenic
1025320445 7:58088373-58088395 AGCCTGCTTCACCCCCTTGGAGG + Intergenic
1026163195 7:67888634-67888656 TGCCTGGCTTACCACCGTCTGGG + Intergenic
1026163509 7:67890232-67890254 TGCCTGGTTGCCAACCTTCTGGG + Intergenic
1026215510 7:68344923-68344945 TGAGTGCTTCATCAACTTCTTGG - Intergenic
1028099621 7:86803958-86803980 TATCTGCTTGACCACCTTCACGG - Intronic
1029241622 7:99167244-99167266 TACCTTCTTCACCTCCTTCAGGG + Intergenic
1031598225 7:123672080-123672102 TACCAGCTTCCCCACCTTCTTGG + Intergenic
1032390775 7:131554205-131554227 TGCATTCTACACCACCCTCTAGG - Intronic
1032450275 7:132024672-132024694 TGCTTCCTTCACTACCCTCTTGG - Intergenic
1035988611 8:4462575-4462597 TACCTGATTCAGCACTTTCTAGG + Intronic
1036722859 8:11193108-11193130 TGTTTTCTTCACCACCCTCTTGG - Intronic
1040013347 8:42680479-42680501 CTCCTGCTTCACCTCCTTCTTGG + Intergenic
1040829940 8:51665044-51665066 TGCCAGCTGCACCATCTGCTCGG + Intronic
1041830064 8:62143863-62143885 TGCCTGCATCTCCATCTTCTGGG - Intergenic
1045558619 8:103239158-103239180 TGCCAGCTACACCACCTACTAGG + Intergenic
1046890518 8:119416590-119416612 TTCCTGCTTCTCCATCTCCTGGG + Exonic
1048606053 8:135970151-135970173 CTCCTCCTTCCCCACCTTCTTGG + Intergenic
1048643562 8:136391904-136391926 TTCCTGGTTCTCCACCTTATAGG - Intergenic
1052280314 9:26725420-26725442 TGTCTGCCTCACCACCTTTGTGG - Intergenic
1052492411 9:29186751-29186773 TCCTGGCTTCACCACTTTCTAGG + Intergenic
1055278410 9:74645929-74645951 TGCCTACCTGACCTCCTTCTAGG + Intronic
1056389780 9:86130341-86130363 TCTCTGCTTCACCGCTTTCTTGG + Intergenic
1057263022 9:93596661-93596683 TGCATGCATCAACACCTTCCTGG - Intronic
1057560223 9:96122326-96122348 TGCCTGCACCACCAGATTCTAGG - Intergenic
1057911083 9:99021183-99021205 TGCCTGTCTCACCTCCCTCTGGG + Intronic
1058000777 9:99862858-99862880 TGCCTGCACCACATCCTTCTGGG + Intronic
1058836464 9:108862363-108862385 GGCCTGGTTGCCCACCTTCTTGG - Exonic
1059050571 9:110920171-110920193 TTGCTGCCTAACCACCTTCTGGG - Intronic
1061838619 9:133345042-133345064 TGCCTCCTTCTGCTCCTTCTCGG + Intronic
1061848364 9:133400647-133400669 TCCCTGCTGCTGCACCTTCTAGG + Intronic
1062676501 9:137748575-137748597 TGCCTTCTTCCCCACCGCCTCGG + Intronic
1186493329 X:9992426-9992448 GGCCTGCTTCTGCACGTTCTGGG + Intergenic
1186501706 X:10055852-10055874 GGTCTTTTTCACCACCTTCTGGG - Intronic
1187219410 X:17308999-17309021 TGCCTTCTTTATCACCTGCTGGG - Intergenic
1187761173 X:22587225-22587247 TTCCTGCTTCTCCACGTACTTGG + Intergenic
1189276119 X:39787345-39787367 TGCCTGCTTCACCACCTTCTTGG + Intergenic
1189279566 X:39811721-39811743 TGCCTTCTTCTCTCCCTTCTGGG + Intergenic
1189679153 X:43497056-43497078 TGCCTGCCTCATCAGATTCTGGG - Intergenic
1190539595 X:51463508-51463530 TGCCTGAGTCAGCACATTCTTGG - Intergenic
1193061582 X:77213698-77213720 TGCTTGCTTCACCAGCATGTGGG - Intergenic
1199725332 X:150574308-150574330 TGCCTGTTTCACCAGCTCCCGGG - Intronic
1200301811 X:154983947-154983969 AACCAGCTTCTCCACCTTCTTGG - Intronic