ID: 1189276124

View in Genome Browser
Species Human (GRCh38)
Location X:39787364-39787386
Sequence TTGGTGTCATCATATTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189276114_1189276124 16 Left 1189276114 X:39787325-39787347 CCCTTGAGGGGGCCCTCCGATGC 0: 1
1: 8
2: 6
3: 16
4: 47
Right 1189276124 X:39787364-39787386 TTGGTGTCATCATATTTGGCAGG No data
1189276112_1189276124 25 Left 1189276112 X:39787316-39787338 CCCAGGATGCCCTTGAGGGGGCC No data
Right 1189276124 X:39787364-39787386 TTGGTGTCATCATATTTGGCAGG No data
1189276118_1189276124 0 Left 1189276118 X:39787341-39787363 CCGATGCCTGCTTCACCACCTTC 0: 1
1: 9
2: 10
3: 35
4: 440
Right 1189276124 X:39787364-39787386 TTGGTGTCATCATATTTGGCAGG No data
1189276116_1189276124 4 Left 1189276116 X:39787337-39787359 CCCTCCGATGCCTGCTTCACCAC No data
Right 1189276124 X:39787364-39787386 TTGGTGTCATCATATTTGGCAGG No data
1189276120_1189276124 -6 Left 1189276120 X:39787347-39787369 CCTGCTTCACCACCTTCTTGGTG No data
Right 1189276124 X:39787364-39787386 TTGGTGTCATCATATTTGGCAGG No data
1189276117_1189276124 3 Left 1189276117 X:39787338-39787360 CCTCCGATGCCTGCTTCACCACC No data
Right 1189276124 X:39787364-39787386 TTGGTGTCATCATATTTGGCAGG No data
1189276113_1189276124 24 Left 1189276113 X:39787317-39787339 CCAGGATGCCCTTGAGGGGGCCC 0: 8
1: 10
2: 12
3: 20
4: 150
Right 1189276124 X:39787364-39787386 TTGGTGTCATCATATTTGGCAGG No data
1189276115_1189276124 15 Left 1189276115 X:39787326-39787348 CCTTGAGGGGGCCCTCCGATGCC No data
Right 1189276124 X:39787364-39787386 TTGGTGTCATCATATTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189276124 Original CRISPR TTGGTGTCATCATATTTGGC AGG Intergenic
No off target data available for this crispr