ID: 1189281097

View in Genome Browser
Species Human (GRCh38)
Location X:39820705-39820727
Sequence CACAGGTACCACCTGGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189281097_1189281102 -8 Left 1189281097 X:39820705-39820727 CCACCACCCAGGTGGTACCTGTG No data
Right 1189281102 X:39820720-39820742 TACCTGTGCCCGCGCAGGTGAGG No data
1189281097_1189281104 -1 Left 1189281097 X:39820705-39820727 CCACCACCCAGGTGGTACCTGTG No data
Right 1189281104 X:39820727-39820749 GCCCGCGCAGGTGAGGAAAAAGG No data
1189281097_1189281107 6 Left 1189281097 X:39820705-39820727 CCACCACCCAGGTGGTACCTGTG No data
Right 1189281107 X:39820734-39820756 CAGGTGAGGAAAAAGGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189281097 Original CRISPR CACAGGTACCACCTGGGTGG TGG (reversed) Intergenic
No off target data available for this crispr