ID: 1189282920

View in Genome Browser
Species Human (GRCh38)
Location X:39831869-39831891
Sequence CATTGTGCCCTGCCTGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189282920_1189282928 18 Left 1189282920 X:39831869-39831891 CCTACTACAGGCAGGGCACAATG No data
Right 1189282928 X:39831910-39831932 AGCACTTTGGGAGGCCAAGGAGG 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
1189282920_1189282925 9 Left 1189282920 X:39831869-39831891 CCTACTACAGGCAGGGCACAATG No data
Right 1189282925 X:39831901-39831923 TGTAATCCTAGCACTTTGGGAGG 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
1189282920_1189282929 19 Left 1189282920 X:39831869-39831891 CCTACTACAGGCAGGGCACAATG No data
Right 1189282929 X:39831911-39831933 GCACTTTGGGAGGCCAAGGAGGG 0: 3198
1: 93624
2: 217316
3: 239801
4: 152513
1189282920_1189282927 15 Left 1189282920 X:39831869-39831891 CCTACTACAGGCAGGGCACAATG No data
Right 1189282927 X:39831907-39831929 CCTAGCACTTTGGGAGGCCAAGG 0: 6817
1: 95257
2: 215319
3: 232657
4: 146568
1189282920_1189282922 5 Left 1189282920 X:39831869-39831891 CCTACTACAGGCAGGGCACAATG No data
Right 1189282922 X:39831897-39831919 CACCTGTAATCCTAGCACTTTGG 0: 6033
1: 84644
2: 218857
3: 252033
4: 196794
1189282920_1189282930 22 Left 1189282920 X:39831869-39831891 CCTACTACAGGCAGGGCACAATG No data
Right 1189282930 X:39831914-39831936 CTTTGGGAGGCCAAGGAGGGTGG 0: 1980
1: 44531
2: 140101
3: 174142
4: 141066
1189282920_1189282923 6 Left 1189282920 X:39831869-39831891 CCTACTACAGGCAGGGCACAATG No data
Right 1189282923 X:39831898-39831920 ACCTGTAATCCTAGCACTTTGGG 0: 6328
1: 96058
2: 316692
3: 235985
4: 141398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189282920 Original CRISPR CATTGTGCCCTGCCTGTAGT AGG (reversed) Intergenic
No off target data available for this crispr