ID: 1189284246

View in Genome Browser
Species Human (GRCh38)
Location X:39840384-39840406
Sequence CCGCCCGCGCCTATTGACAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189284246_1189284256 13 Left 1189284246 X:39840384-39840406 CCGATGTCAATAGGCGCGGGCGG No data
Right 1189284256 X:39840420-39840442 ATGGCCCGAGAGCTGGGACTGGG No data
1189284246_1189284257 14 Left 1189284246 X:39840384-39840406 CCGATGTCAATAGGCGCGGGCGG No data
Right 1189284257 X:39840421-39840443 TGGCCCGAGAGCTGGGACTGGGG No data
1189284246_1189284252 -6 Left 1189284246 X:39840384-39840406 CCGATGTCAATAGGCGCGGGCGG No data
Right 1189284252 X:39840401-39840423 GGGCGGGTGGGTGGTTCAAATGG No data
1189284246_1189284254 7 Left 1189284246 X:39840384-39840406 CCGATGTCAATAGGCGCGGGCGG No data
Right 1189284254 X:39840414-39840436 GTTCAAATGGCCCGAGAGCTGGG No data
1189284246_1189284253 6 Left 1189284246 X:39840384-39840406 CCGATGTCAATAGGCGCGGGCGG No data
Right 1189284253 X:39840413-39840435 GGTTCAAATGGCCCGAGAGCTGG No data
1189284246_1189284255 12 Left 1189284246 X:39840384-39840406 CCGATGTCAATAGGCGCGGGCGG No data
Right 1189284255 X:39840419-39840441 AATGGCCCGAGAGCTGGGACTGG No data
1189284246_1189284259 17 Left 1189284246 X:39840384-39840406 CCGATGTCAATAGGCGCGGGCGG No data
Right 1189284259 X:39840424-39840446 CCCGAGAGCTGGGACTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189284246 Original CRISPR CCGCCCGCGCCTATTGACAT CGG (reversed) Intergenic
No off target data available for this crispr