ID: 1189284252

View in Genome Browser
Species Human (GRCh38)
Location X:39840401-39840423
Sequence GGGCGGGTGGGTGGTTCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189284246_1189284252 -6 Left 1189284246 X:39840384-39840406 CCGATGTCAATAGGCGCGGGCGG No data
Right 1189284252 X:39840401-39840423 GGGCGGGTGGGTGGTTCAAATGG No data
1189284241_1189284252 30 Left 1189284241 X:39840348-39840370 CCATATGCTGTCTTTAATCTGCC No data
Right 1189284252 X:39840401-39840423 GGGCGGGTGGGTGGTTCAAATGG No data
1189284242_1189284252 9 Left 1189284242 X:39840369-39840391 CCTGTGCAATTCTCACCGATGTC No data
Right 1189284252 X:39840401-39840423 GGGCGGGTGGGTGGTTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189284252 Original CRISPR GGGCGGGTGGGTGGTTCAAA TGG Intergenic
No off target data available for this crispr