ID: 1189284253

View in Genome Browser
Species Human (GRCh38)
Location X:39840413-39840435
Sequence GGTTCAAATGGCCCGAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189284246_1189284253 6 Left 1189284246 X:39840384-39840406 CCGATGTCAATAGGCGCGGGCGG No data
Right 1189284253 X:39840413-39840435 GGTTCAAATGGCCCGAGAGCTGG No data
1189284242_1189284253 21 Left 1189284242 X:39840369-39840391 CCTGTGCAATTCTCACCGATGTC No data
Right 1189284253 X:39840413-39840435 GGTTCAAATGGCCCGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189284253 Original CRISPR GGTTCAAATGGCCCGAGAGC TGG Intergenic
No off target data available for this crispr