ID: 1189284259

View in Genome Browser
Species Human (GRCh38)
Location X:39840424-39840446
Sequence CCCGAGAGCTGGGACTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189284246_1189284259 17 Left 1189284246 X:39840384-39840406 CCGATGTCAATAGGCGCGGGCGG No data
Right 1189284259 X:39840424-39840446 CCCGAGAGCTGGGACTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189284259 Original CRISPR CCCGAGAGCTGGGACTGGGG TGG Intergenic
No off target data available for this crispr