ID: 1189284627

View in Genome Browser
Species Human (GRCh38)
Location X:39842599-39842621
Sequence CAGCTCTTCAGGAGGAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189284622_1189284627 -5 Left 1189284622 X:39842581-39842603 CCATTCTGGTATTCCAGGCAGCT No data
Right 1189284627 X:39842599-39842621 CAGCTCTTCAGGAGGAGAAAGGG No data
1189284621_1189284627 -4 Left 1189284621 X:39842580-39842602 CCCATTCTGGTATTCCAGGCAGC No data
Right 1189284627 X:39842599-39842621 CAGCTCTTCAGGAGGAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189284627 Original CRISPR CAGCTCTTCAGGAGGAGAAA GGG Intergenic
No off target data available for this crispr