ID: 1189293146

View in Genome Browser
Species Human (GRCh38)
Location X:39900124-39900146
Sequence GCAGAAGCCCAGACATAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189293146_1189293149 14 Left 1189293146 X:39900124-39900146 CCCACTTATGTCTGGGCTTCTGC No data
Right 1189293149 X:39900161-39900183 AAAAGAAAAAAAAAATAGATGGG No data
1189293146_1189293148 13 Left 1189293146 X:39900124-39900146 CCCACTTATGTCTGGGCTTCTGC No data
Right 1189293148 X:39900160-39900182 AAAAAGAAAAAAAAAATAGATGG 0: 6
1: 172
2: 5692
3: 50441
4: 97621

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189293146 Original CRISPR GCAGAAGCCCAGACATAAGT GGG (reversed) Intergenic
No off target data available for this crispr