ID: 1189295128

View in Genome Browser
Species Human (GRCh38)
Location X:39912451-39912473
Sequence GCTGAAGCCCAAAAGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189295128_1189295139 26 Left 1189295128 X:39912451-39912473 CCAGCTCCCTTTTGGGCTTCAGC No data
Right 1189295139 X:39912500-39912522 CTTGCAGCTCTGTGACCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189295128 Original CRISPR GCTGAAGCCCAAAAGGGAGC TGG (reversed) Intergenic
No off target data available for this crispr