ID: 1189299404

View in Genome Browser
Species Human (GRCh38)
Location X:39941829-39941851
Sequence GGCCCCCTGTAGGCTTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189299404_1189299412 24 Left 1189299404 X:39941829-39941851 CCACCCAAAGCCTACAGGGGGCC No data
Right 1189299412 X:39941876-39941898 TCCCACCCACAGCAGAGCTGAGG No data
1189299404_1189299416 26 Left 1189299404 X:39941829-39941851 CCACCCAAAGCCTACAGGGGGCC No data
Right 1189299416 X:39941878-39941900 CCACCCACAGCAGAGCTGAGGGG No data
1189299404_1189299414 25 Left 1189299404 X:39941829-39941851 CCACCCAAAGCCTACAGGGGGCC No data
Right 1189299414 X:39941877-39941899 CCCACCCACAGCAGAGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189299404 Original CRISPR GGCCCCCTGTAGGCTTTGGG TGG (reversed) Intergenic