ID: 1189309783

View in Genome Browser
Species Human (GRCh38)
Location X:40011134-40011156
Sequence CTTCCCCTAGGGCAACCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189309783_1189309789 -5 Left 1189309783 X:40011134-40011156 CCCGTGGGTTGCCCTAGGGGAAG 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1189309789 X:40011152-40011174 GGAAGGCCAGAAGAGGCCTCAGG 0: 1
1: 0
2: 1
3: 36
4: 330
1189309783_1189309793 27 Left 1189309783 X:40011134-40011156 CCCGTGGGTTGCCCTAGGGGAAG 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1189309793 X:40011184-40011206 TGTGTCCTGTGCAGTTCCTAGGG 0: 1
1: 0
2: 1
3: 18
4: 193
1189309783_1189309792 26 Left 1189309783 X:40011134-40011156 CCCGTGGGTTGCCCTAGGGGAAG 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1189309792 X:40011183-40011205 CTGTGTCCTGTGCAGTTCCTAGG 0: 1
1: 1
2: 2
3: 35
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189309783 Original CRISPR CTTCCCCTAGGGCAACCCAC GGG (reversed) Intergenic
900593785 1:3471397-3471419 GTTCCGCAAGGGCACCCCACAGG - Intronic
902184189 1:14712779-14712801 ATTCCCCTAGTGCAAGCCATAGG + Intronic
905633280 1:39530950-39530972 CCTCCCCCAGGGCTGCCCACTGG - Intergenic
908568722 1:65386316-65386338 CATCCCCTATGACCACCCACTGG - Intronic
908884015 1:68766978-68767000 CTTTCTCTAGAGCAAACCACTGG + Intergenic
910833709 1:91486262-91486284 CTTCCACTAGGACAACACAGAGG - Intergenic
912505466 1:110152691-110152713 CTTGCCCAAGGTCACCCCACTGG - Intronic
915914876 1:159934822-159934844 CCTCCCCTTGTGCATCCCACAGG - Exonic
919490021 1:198195273-198195295 CTTCCCCTAGGGCCTAGCACAGG + Intronic
922786107 1:228283052-228283074 CCTCCCCTGGCGCCACCCACTGG - Exonic
922885956 1:229020655-229020677 CCTCCACTTGGGCCACCCACTGG + Intergenic
1062954793 10:1532983-1533005 CTTCCCCTGGAGTAACACACAGG - Intronic
1066661597 10:37741998-37742020 CATCCTCTAGGGCCACTCACTGG - Intergenic
1070805972 10:79270915-79270937 CTTTCCCTAGGACACCCCATGGG - Intronic
1072899074 10:99391591-99391613 CTTCCCCCAAGGCCTCCCACAGG + Exonic
1075730401 10:124632140-124632162 CCTCTCCGAGGGCACCCCACAGG + Intronic
1076498272 10:130913814-130913836 CTTCCCTGAGGGCCACCCACTGG - Intergenic
1076773169 10:132678206-132678228 CTTCCCCCAGTGCCACCCCCAGG - Intronic
1078245836 11:9573178-9573200 CGTCCCCTGGGGCGAGCCACTGG - Intergenic
1084654707 11:70508345-70508367 CTTCCCCTAAGGCCACCATCAGG + Intronic
1088814925 11:113414315-113414337 CTGCCCCTAGGGAAGCCCACTGG - Intronic
1089466381 11:118689105-118689127 CTTCCCCCAGGGCAGGCCTCGGG - Intergenic
1091399056 12:171800-171822 CTTCCCCCAGGACAGCCCTCAGG - Intronic
1095355606 12:41269832-41269854 CTTCCCCAAGGATAACCCACAGG - Intronic
1099554360 12:84092049-84092071 GTTCCCCTAGGTCAGCACACAGG + Intergenic
1103231899 12:119338492-119338514 CTTACCCAAGGGCACCCAACGGG + Intronic
1104357616 12:128101601-128101623 CTTCCCCTAGGGTTCTCCACTGG - Intergenic
1104607327 12:130199667-130199689 CTTCCCACAGGGGAAGCCACTGG - Intergenic
1108820159 13:54339279-54339301 CTTCCTCCAGGGCCACCCATGGG + Intergenic
1114755582 14:25255945-25255967 CTTCTCCTAGGGAAAGCAACTGG - Intergenic
1122012281 14:98760036-98760058 TCTCCTCTAGGGCAGCCCACAGG + Intergenic
1128806626 15:70535953-70535975 CTTCCTCTAGAAGAACCCACAGG - Intergenic
1132347706 15:101118519-101118541 CAACCCCAAGGGCAATCCACAGG + Intergenic
1136171275 16:28491339-28491361 CTGCCCCTGGGGCAAACCAGTGG + Intronic
1136542817 16:30937806-30937828 CTTTCCCTGGGGGCACCCACAGG - Intronic
1136629759 16:31483082-31483104 CTTCCCCTGGGGGAATCCAGGGG + Intronic
1138576213 16:57908782-57908804 CCTCCCCTAGGTCAAGCCACCGG + Intronic
1139473115 16:67188818-67188840 CATGCCCTGGAGCAACCCACGGG + Exonic
1143620176 17:8076050-8076072 CTTCCCCAAGGCCAAGCCCCTGG + Intronic
1144876439 17:18399714-18399736 CTTCCCCTAGTGCAGAACACTGG - Intergenic
1145155787 17:20544706-20544728 CTTCCCCTAGTGCAGAACACTGG + Intergenic
1145999225 17:29121461-29121483 CTTCCCCTGTGGCACCCCACTGG - Intronic
1146843226 17:36168771-36168793 CTTCCCCTAGTGCAGAACACTGG + Intronic
1146855536 17:36256712-36256734 CTTCCCCTAGTGCAGAACACTGG + Intronic
1146865085 17:36331663-36331685 CTTCCCCTAGTGCAGAACACTGG - Intronic
1146871442 17:36380623-36380645 CTTCCCCTAGTGCAGAACACTGG + Intronic
1146878801 17:36431705-36431727 CTTCCCCTAGTGCAGAACACTGG + Intronic
1146882745 17:36452851-36452873 CTTCCCCTAGTGCAGAACACTGG + Intergenic
1147067944 17:37932257-37932279 CTTCCCCTAGTGCAGAACACTGG - Intronic
1147074328 17:37981247-37981269 CTTCCCCTAGTGCAGAACACTGG + Intronic
1147079475 17:38011812-38011834 CTTCCCCTAGTGCAGAACACTGG - Intronic
1147085850 17:38060785-38060807 CTTCCCCTAGTGCAGAACACTGG + Intronic
1147095416 17:38135754-38135776 CTTCCCCTAGTGCAGAACACTGG - Intergenic
1147101797 17:38184751-38184773 CTTCCCCTAGTGCAGAACACTGG + Intergenic
1148198216 17:45730049-45730071 CTTTCCCTGGGGTATCCCACGGG + Intergenic
1149846390 17:60011261-60011283 CTTCCCCTAGTGCAGAACACTGG + Intergenic
1150351041 17:64444692-64444714 CTTGCCCTCAGGCAACCCATAGG - Intergenic
1151569356 17:74918340-74918362 CCTCCCCAATGGCATCCCACAGG - Intronic
1151868419 17:76820288-76820310 CTTCCCCTGGGGCACCACAGTGG + Intergenic
1155003401 18:21706942-21706964 CTTCACCTAGTGGATCCCACAGG - Intronic
1157223257 18:45841773-45841795 CTTCCCCTAGGACATCTCAGTGG - Intronic
1158572985 18:58612405-58612427 CTTCCCCTAGGGCACCCACCTGG - Intronic
1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG + Exonic
1160535250 18:79588239-79588261 CTTCCCCAGGGACAAACCACTGG - Intergenic
1161846261 19:6713494-6713516 CTTCCCGTAGAGGAACCTACGGG + Exonic
1162550898 19:11357609-11357631 CTTCCCCTAGGCACACCCCCTGG + Intronic
1163364138 19:16866715-16866737 GTTCTCCTAGGGCAGGCCACAGG - Intronic
1167396293 19:49231671-49231693 CTTCCCCATGGACCACCCACTGG + Intergenic
942127556 2:172842514-172842536 CATCACCTGGGGCAACACACAGG + Intronic
946322015 2:218959873-218959895 CTTCTCCTCGGGCAGCCCGCCGG - Exonic
946891547 2:224282308-224282330 CTTCCCAAAGGACAACTCACTGG - Intergenic
948807372 2:240458883-240458905 CTTCACCCAGGGCACCCCCCAGG + Intronic
1171030241 20:21670209-21670231 CTTCCCCAAGGGAAAGCGACAGG + Intergenic
1174901432 20:54505115-54505137 CTTCCCCAAGGTCAAACCACTGG - Intronic
1178891014 21:36521254-36521276 CTTCCCTTGGGGCAGTCCACTGG - Intronic
1179611938 21:42557633-42557655 CTGCCCCCAAGGCCACCCACTGG + Intronic
1179790508 21:43753573-43753595 CTCCCCCTAGGGAATCCCGCTGG + Exonic
1180021711 21:45132605-45132627 CATCCCCTAAGCCCACCCACAGG - Intronic
1181037354 22:20176323-20176345 CTTCCCCATGTACAACCCACCGG + Intergenic
1181920619 22:26317674-26317696 CTTCCCCAAAGCCAAGCCACTGG + Intronic
1184842085 22:47058027-47058049 CTGCACCTAGGGCAGCCCAAGGG - Intronic
950646146 3:14377993-14378015 CTTCCTTTAGGGGAAGCCACGGG + Intergenic
956849092 3:73211939-73211961 CTTCCCCTAGGGCAACCAGCTGG - Intergenic
958103989 3:89049421-89049443 CCTCCCCTGGTCCAACCCACAGG - Intergenic
961785205 3:129343349-129343371 CCTTCCCTAGGACAGCCCACTGG + Intergenic
962873352 3:139517350-139517372 CTTCTCCTAGTGCCACCCATGGG - Intergenic
969118175 4:4887546-4887568 CCCCCTCTAGGGAAACCCACTGG - Intergenic
969151018 4:5168475-5168497 CTCCCCACAGGGGAACCCACAGG - Intronic
971709489 4:30092937-30092959 CTTCCCGTGGGGCAAGCCTCCGG + Intergenic
976274396 4:83261438-83261460 CTTTCCCAAGAGCAACCAACTGG + Intergenic
988656593 5:33218609-33218631 ATTCCAGTAGGGCAACCAACAGG + Intergenic
989333057 5:40282094-40282116 CTTCCTCTAGGACACCCGACTGG + Intergenic
989949095 5:50275707-50275729 CTTCCACCAGGGCTTCCCACTGG + Intergenic
996705012 5:126488936-126488958 CCTGACCTAGGGCAACCAACAGG - Intronic
998149833 5:139750620-139750642 CCTCCCCTAGGGCAACCTCCAGG - Intergenic
1004504817 6:16238997-16239019 CTTCCCCTAGGCCACCCAACGGG - Intronic
1004622374 6:17342382-17342404 CTTCCTCTACGGTAAACCACAGG - Intergenic
1006900673 6:37499014-37499036 CTTCCCTTAGGGCATCCTCCCGG - Intronic
1007582824 6:42969380-42969402 CTTCCCCTTGGGGAGCTCACTGG - Intronic
1012185953 6:96217368-96217390 CTTCCCCAAGGCCACACCACTGG - Intergenic
1013516908 6:110896623-110896645 CTTCCCTTAGGGCCCTCCACAGG + Intergenic
1019334642 7:477190-477212 CTTCTCCCAGGGGCACCCACCGG - Intergenic
1019738510 7:2661801-2661823 CTTCCACCTGGGCCACCCACCGG + Exonic
1022415260 7:30171831-30171853 CTGCCCCTAGGCCACCCCACTGG - Intergenic
1023955865 7:44885948-44885970 CCTCCTCTAGGGAACCCCACAGG - Intergenic
1024997065 7:55280037-55280059 CTTCCCCATGGGCACCCCTCAGG - Intergenic
1025192199 7:56904314-56904336 CTGCCCCTGGGGCCACACACAGG + Intergenic
1025679751 7:63672616-63672638 CTGCCCCTGGGGCCACACACAGG - Intergenic
1029235961 7:99119239-99119261 CTTCCCCAGAGGCAATCCACTGG - Intronic
1031353007 7:120758517-120758539 CTTGCCCTAGGCCATACCACTGG + Intergenic
1035180318 7:157084738-157084760 CTTGCCCTCTGGGAACCCACAGG - Intergenic
1037130576 8:15403891-15403913 CTACTGCTAGGGCATCCCACTGG + Intergenic
1044454263 8:92374377-92374399 CTTCCTCTAGAGCAAAACACAGG - Intergenic
1045489296 8:102656490-102656512 CTTCCTCCTGGGCAACCCAGAGG + Intergenic
1048280613 8:133102898-133102920 CTCCCCCTACTGCTACCCACAGG - Intronic
1049241236 8:141538317-141538339 CCTCCCCCATCGCAACCCACAGG + Intergenic
1049500339 8:142959707-142959729 CTTCCCGCAGGGCAAGCCTCGGG + Intergenic
1051575610 9:18611976-18611998 CTTCAGCTTGGGCAACCCCCTGG - Intronic
1052903635 9:33816618-33816640 CTTCCCGCAGGCCAGCCCACAGG - Intergenic
1055861692 9:80757966-80757988 CTTCCTCTAGGAAGACCCACAGG + Intergenic
1062035333 9:134380295-134380317 CTGCCCCCAGGCCAAGCCACGGG - Intronic
1188559858 X:31455227-31455249 CTTTACGTAGGGCAACCAACTGG - Intronic
1189309783 X:40011134-40011156 CTTCCCCTAGGGCAACCCACGGG - Intergenic
1190223463 X:48528212-48528234 CTTCCCCTCCTGCCACCCACAGG + Exonic