ID: 1189309993

View in Genome Browser
Species Human (GRCh38)
Location X:40012329-40012351
Sequence ACCTCGGGCCCGAAGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189309993_1189310000 -8 Left 1189309993 X:40012329-40012351 CCTGGGACCTTCGGGCCCGAGGT No data
Right 1189310000 X:40012344-40012366 CCCGAGGTTCGGGAGGGCTAAGG No data
1189309993_1189310004 10 Left 1189309993 X:40012329-40012351 CCTGGGACCTTCGGGCCCGAGGT No data
Right 1189310004 X:40012362-40012384 TAAGGGCGCTCCAGGCGACCAGG No data
1189309993_1189310007 16 Left 1189309993 X:40012329-40012351 CCTGGGACCTTCGGGCCCGAGGT No data
Right 1189310007 X:40012368-40012390 CGCTCCAGGCGACCAGGGTTGGG No data
1189309993_1189310003 2 Left 1189309993 X:40012329-40012351 CCTGGGACCTTCGGGCCCGAGGT No data
Right 1189310003 X:40012354-40012376 GGGAGGGCTAAGGGCGCTCCAGG No data
1189309993_1189310002 -7 Left 1189309993 X:40012329-40012351 CCTGGGACCTTCGGGCCCGAGGT No data
Right 1189310002 X:40012345-40012367 CCGAGGTTCGGGAGGGCTAAGGG No data
1189309993_1189310011 29 Left 1189309993 X:40012329-40012351 CCTGGGACCTTCGGGCCCGAGGT No data
Right 1189310011 X:40012381-40012403 CAGGGTTGGGGTCCAGCCCCAGG No data
1189309993_1189310006 15 Left 1189309993 X:40012329-40012351 CCTGGGACCTTCGGGCCCGAGGT No data
Right 1189310006 X:40012367-40012389 GCGCTCCAGGCGACCAGGGTTGG No data
1189309993_1189310005 11 Left 1189309993 X:40012329-40012351 CCTGGGACCTTCGGGCCCGAGGT No data
Right 1189310005 X:40012363-40012385 AAGGGCGCTCCAGGCGACCAGGG No data
1189309993_1189310008 17 Left 1189309993 X:40012329-40012351 CCTGGGACCTTCGGGCCCGAGGT No data
Right 1189310008 X:40012369-40012391 GCTCCAGGCGACCAGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189309993 Original CRISPR ACCTCGGGCCCGAAGGTCCC AGG (reversed) Intergenic