ID: 1189309996

View in Genome Browser
Species Human (GRCh38)
Location X:40012336-40012358
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189309996_1189310005 4 Left 1189309996 X:40012336-40012358 CCTTCGGGCCCGAGGTTCGGGAG No data
Right 1189310005 X:40012363-40012385 AAGGGCGCTCCAGGCGACCAGGG No data
1189309996_1189310006 8 Left 1189309996 X:40012336-40012358 CCTTCGGGCCCGAGGTTCGGGAG No data
Right 1189310006 X:40012367-40012389 GCGCTCCAGGCGACCAGGGTTGG No data
1189309996_1189310003 -5 Left 1189309996 X:40012336-40012358 CCTTCGGGCCCGAGGTTCGGGAG No data
Right 1189310003 X:40012354-40012376 GGGAGGGCTAAGGGCGCTCCAGG No data
1189309996_1189310007 9 Left 1189309996 X:40012336-40012358 CCTTCGGGCCCGAGGTTCGGGAG No data
Right 1189310007 X:40012368-40012390 CGCTCCAGGCGACCAGGGTTGGG No data
1189309996_1189310011 22 Left 1189309996 X:40012336-40012358 CCTTCGGGCCCGAGGTTCGGGAG No data
Right 1189310011 X:40012381-40012403 CAGGGTTGGGGTCCAGCCCCAGG No data
1189309996_1189310004 3 Left 1189309996 X:40012336-40012358 CCTTCGGGCCCGAGGTTCGGGAG No data
Right 1189310004 X:40012362-40012384 TAAGGGCGCTCCAGGCGACCAGG No data
1189309996_1189310008 10 Left 1189309996 X:40012336-40012358 CCTTCGGGCCCGAGGTTCGGGAG No data
Right 1189310008 X:40012369-40012391 GCTCCAGGCGACCAGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189309996 Original CRISPR CTCCCGAACCTCGGGCCCGA AGG (reversed) Intergenic