ID: 1189310001

View in Genome Browser
Species Human (GRCh38)
Location X:40012345-40012367
Sequence CCCTTAGCCCTCCCGAACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189310001_1189310004 -6 Left 1189310001 X:40012345-40012367 CCGAGGTTCGGGAGGGCTAAGGG No data
Right 1189310004 X:40012362-40012384 TAAGGGCGCTCCAGGCGACCAGG No data
1189310001_1189310008 1 Left 1189310001 X:40012345-40012367 CCGAGGTTCGGGAGGGCTAAGGG No data
Right 1189310008 X:40012369-40012391 GCTCCAGGCGACCAGGGTTGGGG No data
1189310001_1189310011 13 Left 1189310001 X:40012345-40012367 CCGAGGTTCGGGAGGGCTAAGGG No data
Right 1189310011 X:40012381-40012403 CAGGGTTGGGGTCCAGCCCCAGG No data
1189310001_1189310012 23 Left 1189310001 X:40012345-40012367 CCGAGGTTCGGGAGGGCTAAGGG No data
Right 1189310012 X:40012391-40012413 GTCCAGCCCCAGGATTAGCGCGG No data
1189310001_1189310014 28 Left 1189310001 X:40012345-40012367 CCGAGGTTCGGGAGGGCTAAGGG No data
Right 1189310014 X:40012396-40012418 GCCCCAGGATTAGCGCGGCCAGG No data
1189310001_1189310005 -5 Left 1189310001 X:40012345-40012367 CCGAGGTTCGGGAGGGCTAAGGG No data
Right 1189310005 X:40012363-40012385 AAGGGCGCTCCAGGCGACCAGGG No data
1189310001_1189310006 -1 Left 1189310001 X:40012345-40012367 CCGAGGTTCGGGAGGGCTAAGGG No data
Right 1189310006 X:40012367-40012389 GCGCTCCAGGCGACCAGGGTTGG No data
1189310001_1189310007 0 Left 1189310001 X:40012345-40012367 CCGAGGTTCGGGAGGGCTAAGGG No data
Right 1189310007 X:40012368-40012390 CGCTCCAGGCGACCAGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189310001 Original CRISPR CCCTTAGCCCTCCCGAACCT CGG (reversed) Intergenic
No off target data available for this crispr