ID: 1189310004

View in Genome Browser
Species Human (GRCh38)
Location X:40012362-40012384
Sequence TAAGGGCGCTCCAGGCGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189309991_1189310004 11 Left 1189309991 X:40012328-40012350 CCCTGGGACCTTCGGGCCCGAGG No data
Right 1189310004 X:40012362-40012384 TAAGGGCGCTCCAGGCGACCAGG No data
1189310001_1189310004 -6 Left 1189310001 X:40012345-40012367 CCGAGGTTCGGGAGGGCTAAGGG No data
Right 1189310004 X:40012362-40012384 TAAGGGCGCTCCAGGCGACCAGG No data
1189309990_1189310004 17 Left 1189309990 X:40012322-40012344 CCGGCACCCTGGGACCTTCGGGC No data
Right 1189310004 X:40012362-40012384 TAAGGGCGCTCCAGGCGACCAGG No data
1189309993_1189310004 10 Left 1189309993 X:40012329-40012351 CCTGGGACCTTCGGGCCCGAGGT No data
Right 1189310004 X:40012362-40012384 TAAGGGCGCTCCAGGCGACCAGG No data
1189309996_1189310004 3 Left 1189309996 X:40012336-40012358 CCTTCGGGCCCGAGGTTCGGGAG No data
Right 1189310004 X:40012362-40012384 TAAGGGCGCTCCAGGCGACCAGG No data
1189309999_1189310004 -5 Left 1189309999 X:40012344-40012366 CCCGAGGTTCGGGAGGGCTAAGG No data
Right 1189310004 X:40012362-40012384 TAAGGGCGCTCCAGGCGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189310004 Original CRISPR TAAGGGCGCTCCAGGCGACC AGG Intergenic
No off target data available for this crispr