ID: 1189310009

View in Genome Browser
Species Human (GRCh38)
Location X:40012372-40012394
Sequence GGACCCCAACCCTGGTCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189310009_1189310014 1 Left 1189310009 X:40012372-40012394 CCAGGCGACCAGGGTTGGGGTCC No data
Right 1189310014 X:40012396-40012418 GCCCCAGGATTAGCGCGGCCAGG No data
1189310009_1189310022 30 Left 1189310009 X:40012372-40012394 CCAGGCGACCAGGGTTGGGGTCC No data
Right 1189310022 X:40012425-40012447 TCTGCCCGCAGCTGCCGCGGAGG No data
1189310009_1189310012 -4 Left 1189310009 X:40012372-40012394 CCAGGCGACCAGGGTTGGGGTCC No data
Right 1189310012 X:40012391-40012413 GTCCAGCCCCAGGATTAGCGCGG No data
1189310009_1189310020 27 Left 1189310009 X:40012372-40012394 CCAGGCGACCAGGGTTGGGGTCC No data
Right 1189310020 X:40012422-40012444 CCCTCTGCCCGCAGCTGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189310009 Original CRISPR GGACCCCAACCCTGGTCGCC TGG (reversed) Intergenic
No off target data available for this crispr