ID: 1189310010

View in Genome Browser
Species Human (GRCh38)
Location X:40012380-40012402
Sequence CTGGGGCTGGACCCCAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189310010_1189310022 22 Left 1189310010 X:40012380-40012402 CCAGGGTTGGGGTCCAGCCCCAG No data
Right 1189310022 X:40012425-40012447 TCTGCCCGCAGCTGCCGCGGAGG No data
1189310010_1189310020 19 Left 1189310010 X:40012380-40012402 CCAGGGTTGGGGTCCAGCCCCAG No data
Right 1189310020 X:40012422-40012444 CCCTCTGCCCGCAGCTGCCGCGG No data
1189310010_1189310023 23 Left 1189310010 X:40012380-40012402 CCAGGGTTGGGGTCCAGCCCCAG No data
Right 1189310023 X:40012426-40012448 CTGCCCGCAGCTGCCGCGGAGGG No data
1189310010_1189310024 24 Left 1189310010 X:40012380-40012402 CCAGGGTTGGGGTCCAGCCCCAG No data
Right 1189310024 X:40012427-40012449 TGCCCGCAGCTGCCGCGGAGGGG No data
1189310010_1189310027 30 Left 1189310010 X:40012380-40012402 CCAGGGTTGGGGTCCAGCCCCAG No data
Right 1189310027 X:40012433-40012455 CAGCTGCCGCGGAGGGGTTGAGG No data
1189310010_1189310014 -7 Left 1189310010 X:40012380-40012402 CCAGGGTTGGGGTCCAGCCCCAG No data
Right 1189310014 X:40012396-40012418 GCCCCAGGATTAGCGCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189310010 Original CRISPR CTGGGGCTGGACCCCAACCC TGG (reversed) Intergenic
No off target data available for this crispr