ID: 1189310012

View in Genome Browser
Species Human (GRCh38)
Location X:40012391-40012413
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189309999_1189310012 24 Left 1189309999 X:40012344-40012366 CCCGAGGTTCGGGAGGGCTAAGG No data
Right 1189310012 X:40012391-40012413 GTCCAGCCCCAGGATTAGCGCGG No data
1189310001_1189310012 23 Left 1189310001 X:40012345-40012367 CCGAGGTTCGGGAGGGCTAAGGG No data
Right 1189310012 X:40012391-40012413 GTCCAGCCCCAGGATTAGCGCGG No data
1189310009_1189310012 -4 Left 1189310009 X:40012372-40012394 CCAGGCGACCAGGGTTGGGGTCC No data
Right 1189310012 X:40012391-40012413 GTCCAGCCCCAGGATTAGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189310012 Original CRISPR GTCCAGCCCCAGGATTAGCG CGG Intergenic