ID: 1189310014

View in Genome Browser
Species Human (GRCh38)
Location X:40012396-40012418
Sequence GCCCCAGGATTAGCGCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189309999_1189310014 29 Left 1189309999 X:40012344-40012366 CCCGAGGTTCGGGAGGGCTAAGG No data
Right 1189310014 X:40012396-40012418 GCCCCAGGATTAGCGCGGCCAGG No data
1189310010_1189310014 -7 Left 1189310010 X:40012380-40012402 CCAGGGTTGGGGTCCAGCCCCAG No data
Right 1189310014 X:40012396-40012418 GCCCCAGGATTAGCGCGGCCAGG No data
1189310009_1189310014 1 Left 1189310009 X:40012372-40012394 CCAGGCGACCAGGGTTGGGGTCC No data
Right 1189310014 X:40012396-40012418 GCCCCAGGATTAGCGCGGCCAGG No data
1189310001_1189310014 28 Left 1189310001 X:40012345-40012367 CCGAGGTTCGGGAGGGCTAAGGG No data
Right 1189310014 X:40012396-40012418 GCCCCAGGATTAGCGCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189310014 Original CRISPR GCCCCAGGATTAGCGCGGCC AGG Intergenic
No off target data available for this crispr