ID: 1189310020

View in Genome Browser
Species Human (GRCh38)
Location X:40012422-40012444
Sequence CCCTCTGCCCGCAGCTGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189310017_1189310020 0 Left 1189310017 X:40012399-40012421 CCAGGATTAGCGCGGCCAGGAAT No data
Right 1189310020 X:40012422-40012444 CCCTCTGCCCGCAGCTGCCGCGG No data
1189310015_1189310020 2 Left 1189310015 X:40012397-40012419 CCCCAGGATTAGCGCGGCCAGGA No data
Right 1189310020 X:40012422-40012444 CCCTCTGCCCGCAGCTGCCGCGG No data
1189310013_1189310020 6 Left 1189310013 X:40012393-40012415 CCAGCCCCAGGATTAGCGCGGCC No data
Right 1189310020 X:40012422-40012444 CCCTCTGCCCGCAGCTGCCGCGG No data
1189310010_1189310020 19 Left 1189310010 X:40012380-40012402 CCAGGGTTGGGGTCCAGCCCCAG No data
Right 1189310020 X:40012422-40012444 CCCTCTGCCCGCAGCTGCCGCGG No data
1189310016_1189310020 1 Left 1189310016 X:40012398-40012420 CCCAGGATTAGCGCGGCCAGGAA No data
Right 1189310020 X:40012422-40012444 CCCTCTGCCCGCAGCTGCCGCGG No data
1189310009_1189310020 27 Left 1189310009 X:40012372-40012394 CCAGGCGACCAGGGTTGGGGTCC No data
Right 1189310020 X:40012422-40012444 CCCTCTGCCCGCAGCTGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189310020 Original CRISPR CCCTCTGCCCGCAGCTGCCG CGG Intergenic
No off target data available for this crispr