ID: 1189310604

View in Genome Browser
Species Human (GRCh38)
Location X:40014818-40014840
Sequence GCGCGCGCGCGCTCGTGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189310604_1189310606 15 Left 1189310604 X:40014818-40014840 CCGCTCCACGAGCGCGCGCGCGC No data
Right 1189310606 X:40014856-40014878 CACACACACACGCCGCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189310604 Original CRISPR GCGCGCGCGCGCTCGTGGAG CGG (reversed) Intergenic