ID: 1189311610

View in Genome Browser
Species Human (GRCh38)
Location X:40022788-40022810
Sequence GGACTAAGTAATTTGAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189311610_1189311615 8 Left 1189311610 X:40022788-40022810 CCCATATTCAAATTACTTAGTCC No data
Right 1189311615 X:40022819-40022841 CTGTGAGCTCAGATGGAAAAAGG No data
1189311610_1189311616 9 Left 1189311610 X:40022788-40022810 CCCATATTCAAATTACTTAGTCC No data
Right 1189311616 X:40022820-40022842 TGTGAGCTCAGATGGAAAAAGGG No data
1189311610_1189311614 1 Left 1189311610 X:40022788-40022810 CCCATATTCAAATTACTTAGTCC No data
Right 1189311614 X:40022812-40022834 ACTCTTTCTGTGAGCTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189311610 Original CRISPR GGACTAAGTAATTTGAATAT GGG (reversed) Intergenic
No off target data available for this crispr