ID: 1189311615

View in Genome Browser
Species Human (GRCh38)
Location X:40022819-40022841
Sequence CTGTGAGCTCAGATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189311611_1189311615 7 Left 1189311611 X:40022789-40022811 CCATATTCAAATTACTTAGTCCC No data
Right 1189311615 X:40022819-40022841 CTGTGAGCTCAGATGGAAAAAGG No data
1189311610_1189311615 8 Left 1189311610 X:40022788-40022810 CCCATATTCAAATTACTTAGTCC No data
Right 1189311615 X:40022819-40022841 CTGTGAGCTCAGATGGAAAAAGG No data
1189311609_1189311615 12 Left 1189311609 X:40022784-40022806 CCATCCCATATTCAAATTACTTA No data
Right 1189311615 X:40022819-40022841 CTGTGAGCTCAGATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189311615 Original CRISPR CTGTGAGCTCAGATGGAAAA AGG Intergenic
No off target data available for this crispr