ID: 1189313234

View in Genome Browser
Species Human (GRCh38)
Location X:40034720-40034742
Sequence TGCCATTGCAGCAATGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189313227_1189313234 -1 Left 1189313227 X:40034698-40034720 CCAAAGACCTGGCAGCCCAGAGT No data
Right 1189313234 X:40034720-40034742 TGCCATTGCAGCAATGGGCTGGG No data
1189313228_1189313234 -8 Left 1189313228 X:40034705-40034727 CCTGGCAGCCCAGAGTGCCATTG No data
Right 1189313234 X:40034720-40034742 TGCCATTGCAGCAATGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189313234 Original CRISPR TGCCATTGCAGCAATGGGCT GGG Intergenic
No off target data available for this crispr