ID: 1189314010

View in Genome Browser
Species Human (GRCh38)
Location X:40040907-40040929
Sequence TAAAAGAAGGAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189314010_1189314023 29 Left 1189314010 X:40040907-40040929 CCCTCCTCCTTCTCCTTCTTTTA No data
Right 1189314023 X:40040959-40040981 CCCAAATGTATCTACTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189314010 Original CRISPR TAAAAGAAGGAGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr