ID: 1189314436

View in Genome Browser
Species Human (GRCh38)
Location X:40044247-40044269
Sequence CACATCTAGCACTAAGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189314436_1189314437 -8 Left 1189314436 X:40044247-40044269 CCAAGAACTTAGTGCTAGATGTG No data
Right 1189314437 X:40044262-40044284 TAGATGTGCTCATTGCTACTAGG 0: 9
1: 36
2: 132
3: 276
4: 519
1189314436_1189314438 -7 Left 1189314436 X:40044247-40044269 CCAAGAACTTAGTGCTAGATGTG No data
Right 1189314438 X:40044263-40044285 AGATGTGCTCATTGCTACTAGGG No data
1189314436_1189314439 10 Left 1189314436 X:40044247-40044269 CCAAGAACTTAGTGCTAGATGTG No data
Right 1189314439 X:40044280-40044302 CTAGGGTGTCAACGTTTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189314436 Original CRISPR CACATCTAGCACTAAGTTCT TGG (reversed) Intergenic
No off target data available for this crispr