ID: 1189317412

View in Genome Browser
Species Human (GRCh38)
Location X:40065850-40065872
Sequence ATTTGAAGTGGGTTGGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189317412_1189317422 21 Left 1189317412 X:40065850-40065872 CCTCTCCCCAACCCACTTCAAAT No data
Right 1189317422 X:40065894-40065916 CACCGCTCACCCGCTTCTCTCGG No data
1189317412_1189317423 22 Left 1189317412 X:40065850-40065872 CCTCTCCCCAACCCACTTCAAAT No data
Right 1189317423 X:40065895-40065917 ACCGCTCACCCGCTTCTCTCGGG No data
1189317412_1189317426 24 Left 1189317412 X:40065850-40065872 CCTCTCCCCAACCCACTTCAAAT No data
Right 1189317426 X:40065897-40065919 CGCTCACCCGCTTCTCTCGGGGG No data
1189317412_1189317425 23 Left 1189317412 X:40065850-40065872 CCTCTCCCCAACCCACTTCAAAT No data
Right 1189317425 X:40065896-40065918 CCGCTCACCCGCTTCTCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189317412 Original CRISPR ATTTGAAGTGGGTTGGGGAG AGG (reversed) Intronic