ID: 1189317414

View in Genome Browser
Species Human (GRCh38)
Location X:40065856-40065878
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189317414_1189317429 30 Left 1189317414 X:40065856-40065878 CCCAACCCACTTCAAATATTACT No data
Right 1189317429 X:40065909-40065931 TCTCTCGGGGGCATTGCCAGCGG No data
1189317414_1189317422 15 Left 1189317414 X:40065856-40065878 CCCAACCCACTTCAAATATTACT No data
Right 1189317422 X:40065894-40065916 CACCGCTCACCCGCTTCTCTCGG No data
1189317414_1189317425 17 Left 1189317414 X:40065856-40065878 CCCAACCCACTTCAAATATTACT No data
Right 1189317425 X:40065896-40065918 CCGCTCACCCGCTTCTCTCGGGG No data
1189317414_1189317423 16 Left 1189317414 X:40065856-40065878 CCCAACCCACTTCAAATATTACT No data
Right 1189317423 X:40065895-40065917 ACCGCTCACCCGCTTCTCTCGGG No data
1189317414_1189317426 18 Left 1189317414 X:40065856-40065878 CCCAACCCACTTCAAATATTACT No data
Right 1189317426 X:40065897-40065919 CGCTCACCCGCTTCTCTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189317414 Original CRISPR AGTAATATTTGAAGTGGGTT GGG (reversed) Intronic