ID: 1189317415

View in Genome Browser
Species Human (GRCh38)
Location X:40065857-40065879
Sequence GAGTAATATTTGAAGTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189317415_1189317425 16 Left 1189317415 X:40065857-40065879 CCAACCCACTTCAAATATTACTC 0: 1
1: 0
2: 1
3: 8
4: 145
Right 1189317425 X:40065896-40065918 CCGCTCACCCGCTTCTCTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 93
1189317415_1189317422 14 Left 1189317415 X:40065857-40065879 CCAACCCACTTCAAATATTACTC 0: 1
1: 0
2: 1
3: 8
4: 145
Right 1189317422 X:40065894-40065916 CACCGCTCACCCGCTTCTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 91
1189317415_1189317426 17 Left 1189317415 X:40065857-40065879 CCAACCCACTTCAAATATTACTC 0: 1
1: 0
2: 1
3: 8
4: 145
Right 1189317426 X:40065897-40065919 CGCTCACCCGCTTCTCTCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 75
1189317415_1189317423 15 Left 1189317415 X:40065857-40065879 CCAACCCACTTCAAATATTACTC 0: 1
1: 0
2: 1
3: 8
4: 145
Right 1189317423 X:40065895-40065917 ACCGCTCACCCGCTTCTCTCGGG 0: 1
1: 0
2: 1
3: 8
4: 91
1189317415_1189317429 29 Left 1189317415 X:40065857-40065879 CCAACCCACTTCAAATATTACTC 0: 1
1: 0
2: 1
3: 8
4: 145
Right 1189317429 X:40065909-40065931 TCTCTCGGGGGCATTGCCAGCGG 0: 1
1: 0
2: 0
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189317415 Original CRISPR GAGTAATATTTGAAGTGGGT TGG (reversed) Intronic
902986066 1:20154998-20155020 GAGCAGCATTAGAAGTGGGTTGG + Intergenic
903300689 1:22376488-22376510 GAGTCAAATTGGAACTGGGTGGG + Intergenic
903646413 1:24898760-24898782 GAGTGGTTTTTGAAGTCGGTGGG + Intergenic
909308841 1:74119693-74119715 GAGTATTATTTTAATTTGGTGGG - Intronic
909959933 1:81827653-81827675 GAGAAATGCTTGAAGTGGGGAGG - Intronic
910132414 1:83924216-83924238 GAGTACTATTTGAAATGTGGGGG + Intronic
913060266 1:115198006-115198028 GAAGAATTTTTGAAGGGGGTTGG - Intergenic
915758417 1:158286231-158286253 GAGAATAATCTGAAGTGGGTAGG - Intergenic
918885250 1:190184725-190184747 GAGTACTACTAGAAGTGGGAAGG + Intronic
922024604 1:221738977-221738999 GAGGACTATGTGAAGTGGCTGGG + Exonic
922655389 1:227377957-227377979 GAGTGAGATTTGAATGGGGTGGG - Intergenic
1068487716 10:57680979-57681001 CAGTAGTTTTTGAGGTGGGTAGG - Intergenic
1068852528 10:61760290-61760312 GAGAAATATTTGTATTTGGTTGG - Intronic
1069218374 10:65851707-65851729 AAGTAATATAGGAAGTTGGTGGG + Intergenic
1076625839 10:131821386-131821408 GATCAATATTCAAAGTGGGTAGG + Intergenic
1077456352 11:2683592-2683614 GAGCAGTATTTGAAATGAGTTGG - Intronic
1080297850 11:30750874-30750896 GAGTCAAAGTTGAAATGGGTGGG - Intergenic
1082154234 11:48783975-48783997 AAGTGATATTTGAAGTGCTTTGG - Intergenic
1088962257 11:114680594-114680616 CACTAATATTGGTAGTGGGTAGG - Intronic
1090779341 11:129993467-129993489 GTGTAATATTGGCACTGGGTAGG - Intronic
1093286783 12:17273502-17273524 GATTAATATTTGAAATAGGAGGG + Intergenic
1096787295 12:54024548-54024570 GAGGGATATTTGAAGTGAGAGGG - Intronic
1098863581 12:75736766-75736788 GTGTAATATTAGAAGTGTTTGGG - Intergenic
1098996993 12:77132305-77132327 GAGTAATAATTGATGTGGTCTGG - Intergenic
1099650982 12:85428000-85428022 GAGTGATGTTTGCGGTGGGTGGG - Intergenic
1100071893 12:90731046-90731068 GATTTCTATTTGAAGTAGGTTGG + Intergenic
1102774936 12:115510356-115510378 GAGTAAAGTTTGAGGTGGGTTGG - Intergenic
1103513445 12:121490907-121490929 GAGTGGTATTTGATCTGGGTCGG - Intronic
1105974406 13:25460464-25460486 GAGTAATTTTTCATATGGGTTGG - Intronic
1110019348 13:70450459-70450481 GATTAATATTAGAAGTGTTTTGG - Intergenic
1112003903 13:95237735-95237757 AAGGAATATCTGAAGTGCGTGGG - Intronic
1114570292 14:23662128-23662150 GAGTAATTTTTGACATGGGGAGG - Intergenic
1116543368 14:46129815-46129837 GGGTAATGTTTGAAGAAGGTAGG + Intergenic
1117143118 14:52810016-52810038 GAGTAGTGTCTGAAGTGGGGAGG - Intergenic
1117429768 14:55645111-55645133 TATTAATATTTGAAGGAGGTGGG + Intronic
1117745555 14:58865830-58865852 GAGTGAAATTTGATGTGGGCGGG - Intergenic
1118858363 14:69641898-69641920 AAAGAATATTTGAAGTGGCTAGG - Intronic
1119627362 14:76190724-76190746 CAGTAATTTTCGAAGTAGGTAGG + Intronic
1119674312 14:76542385-76542407 GTGCAATATTTCAAGTGGCTGGG - Intergenic
1125019857 15:34973776-34973798 GAGTAGTATGTCAAATGGGTTGG + Intergenic
1125144746 15:36453736-36453758 GAGTGAAATTTGAATTAGGTAGG - Intergenic
1126221459 15:46219087-46219109 GGGTAATTTTTGAGGTGTGTCGG - Intergenic
1127794188 15:62424407-62424429 GAGTGAGATCTGCAGTGGGTAGG + Intronic
1129023310 15:72544374-72544396 GAGTAATATTTTACATGGGTAGG - Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131145434 15:90008477-90008499 AAGAACTATTAGAAGTGGGTTGG + Intronic
1140382941 16:74506881-74506903 GAGTAAACTCTGAAGTGGCTGGG + Intronic
1141925916 16:87169475-87169497 GAGTAAAGTGTGAACTGGGTAGG - Intronic
1145752566 17:27365936-27365958 GAATAATAATAGAAGTGGGCCGG - Intergenic
1151289881 17:73142052-73142074 GAGAATTACTTGAAGTGGGGAGG - Intergenic
1159030115 18:63222182-63222204 GAGTAATATCTGAACTTGGGAGG + Intronic
1159510474 18:69392099-69392121 AAATAATATTTGAAGGAGGTAGG + Intergenic
1159812848 18:73037346-73037368 AAATAATTTTTAAAGTGGGTGGG - Intergenic
1162892581 19:13744681-13744703 GAGAAATTTTTAAAGAGGGTAGG - Intronic
1166033615 19:40151427-40151449 GAGTCATGCTTGAAGGGGGTTGG + Intergenic
1166164264 19:40976064-40976086 GAGAATTACTTGAAGTGGGGAGG + Intergenic
925096975 2:1213437-1213459 GTTTAATATTTGAAGTGTTTTGG - Intronic
929852391 2:45604261-45604283 GAATTTTATTTGAAGTGGGTTGG - Intronic
930834487 2:55778494-55778516 GAGAAACCTTTGACGTGGGTGGG + Intergenic
935588419 2:104823084-104823106 CATTAATATTTGAAGGGGGAAGG + Intergenic
936472824 2:112814027-112814049 GAGCCATATTGCAAGTGGGTTGG + Intergenic
939201244 2:139037782-139037804 GAATGATATTTGAAGTAGCTAGG - Intergenic
939737936 2:145872737-145872759 GTCTAATATTAGAAGTGGGGAGG + Intergenic
940809762 2:158229243-158229265 GAGGATGATTGGAAGTGGGTAGG - Intronic
942008336 2:171732414-171732436 GCTTAATATTTGAAGTGTTTAGG + Intronic
942835400 2:180289944-180289966 GAGGAACATCTGAATTGGGTTGG + Intergenic
943077018 2:183208196-183208218 GAGAAATATTTGCAGTGAGAAGG + Intergenic
945741725 2:213671589-213671611 GAGCAATAGTTGAAGTTGGAAGG - Intronic
1169290374 20:4344517-4344539 AAGTAATATTTGAAGAAAGTAGG + Intergenic
1169974921 20:11313758-11313780 GAGTAACATTTGATGGGGATTGG + Intergenic
1172103652 20:32502236-32502258 GAGTAGAAATTGAAGTGGGGAGG + Intronic
1176985504 21:15431364-15431386 GAGTAACATGGGAAGTGTGTTGG - Intergenic
1178878807 21:36432578-36432600 TAGTAAGAAGTGAAGTGGGTGGG - Intergenic
1179011172 21:37557411-37557433 GAGGAAGATTTGAAGTGACTGGG + Intergenic
953649591 3:44789886-44789908 GTTTAATATTAGAAGTGTGTTGG - Intronic
955018675 3:55097223-55097245 GAGGGATATTAGAAGTGGTTTGG + Intergenic
955090274 3:55743681-55743703 GAGTAATATTTCATTTGTGTGGG - Intronic
955438470 3:58930316-58930338 TAGTAATATTTGCAGTGATTTGG - Intronic
955970186 3:64431249-64431271 GTTTAATATTTGAAGTGTTTTGG - Intronic
956991103 3:74766627-74766649 GAATATTTTTTGAAGTAGGTGGG + Intergenic
958003819 3:87786676-87786698 CAGTAATATTTGAAATGCATGGG - Intergenic
958606924 3:96370915-96370937 GAGAAAAATTTAAAATGGGTGGG + Intergenic
958707923 3:97679365-97679387 GAGTAGCATTTGAAGTGTGTGGG + Intronic
958890943 3:99782224-99782246 GAGGAATATTTAAGGGGGGTAGG + Intronic
959527264 3:107391008-107391030 TAATCCTATTTGAAGTGGGTTGG - Intergenic
962116310 3:132512488-132512510 GATTAGGATTTGAGGTGGGTAGG + Intronic
962213045 3:133495313-133495335 AAGTAATAATTGACGTGGGCAGG - Intergenic
963508755 3:146221804-146221826 GAATAATCTTTGAAGTTTGTGGG - Intronic
970579549 4:17462662-17462684 TACTAATATTTCAAGTGGCTTGG + Intronic
972285733 4:37646183-37646205 CAGTGATATTTGAGGTGTGTGGG - Intronic
972669419 4:41200005-41200027 GAGTAATTCTTGAAGTGGGTTGG - Intronic
972669422 4:41200045-41200067 GAGTAATTCTTGAAATGGGTTGG - Intronic
973812853 4:54589131-54589153 GATTACTATTTGAAGGGTGTAGG + Intergenic
975101921 4:70523369-70523391 GAGGAAGAGTTGAAGTGGGAGGG - Intronic
979296520 4:119038795-119038817 GAGGAATCTTTGAGGTGGGAAGG - Intronic
980129697 4:128807160-128807182 GAGTCATATTGGGAGTTGGTGGG + Intergenic
980226180 4:129989205-129989227 TAGTAATAATTCAAGTGTGTGGG - Intergenic
980819761 4:137998692-137998714 GAATACCATTTCAAGTGGGTAGG - Intergenic
981511026 4:145558583-145558605 TAGGAGTATTTGAGGTGGGTGGG + Intergenic
981752398 4:148104973-148104995 GAATAAAATATGAAGTGAGTGGG + Intronic
986082229 5:4407024-4407046 AAGTATTATTTAAAGTGTGTGGG + Intergenic
986364413 5:7016468-7016490 GAGTAATATTTGGAATTGGAGGG + Intergenic
987978002 5:25041216-25041238 GAGAAAGATTTGAAGTTGATAGG - Intergenic
988615429 5:32770338-32770360 GAGGAACACTTGAACTGGGTAGG + Intronic
989347067 5:40440960-40440982 GATGAATATTTCAAGTGAGTAGG + Intergenic
991088610 5:62671788-62671810 GAGAAATAGTTGAAGAGGCTTGG - Intergenic
992108669 5:73471826-73471848 GACTAATATTAGGGGTGGGTGGG + Intergenic
992850987 5:80807354-80807376 GTTTAATATTAGAAGTGTGTTGG - Intronic
993489760 5:88532641-88532663 CAGTAATATGTCAAGTGGGGTGG - Intergenic
997092679 5:130875835-130875857 TAGTAATATTGGAAGTGGTGTGG - Intergenic
997985353 5:138496928-138496950 GTTTAATATTAGAAGTTGGTGGG + Intergenic
998219487 5:140265023-140265045 GAGTAAAATTTGAGGGAGGTGGG - Intronic
998464627 5:142333500-142333522 GAGTAATATGTGAATGGGCTGGG + Intergenic
999880226 5:155854945-155854967 GAGTAATAGTTGACTTGGGTAGG - Intergenic
1003624557 6:7729188-7729210 CAATAAAATTTGTAGTGGGTGGG + Intronic
1005398022 6:25404097-25404119 GAGTAATCTTAGAAGTGGAGGGG - Intronic
1009762467 6:68025247-68025269 TAGAAATTTTTGAAGAGGGTTGG + Intergenic
1010809827 6:80288807-80288829 GAGTAATATCTGAAAAGGCTGGG - Intronic
1014866162 6:126532942-126532964 GATAAATAATTGAAGTGGGCTGG + Intergenic
1015057275 6:128919047-128919069 GAGTCAGATTTGAAGTCAGTAGG - Intronic
1015842896 6:137492512-137492534 GAATAAAGTTTGAAGGGGGTGGG + Exonic
1019664823 7:2246646-2246668 GTGTAATATTTACAGAGGGTAGG - Intronic
1021291816 7:18854727-18854749 GGGTAATTTTTTAAATGGGTGGG + Intronic
1024105312 7:46078544-46078566 ATGTTATATTTGAAGTGAGTTGG - Intergenic
1024876761 7:54034444-54034466 GACTTACATTTGAAGTGGTTGGG + Intergenic
1029173686 7:98648394-98648416 GAGAATCATTTGAACTGGGTAGG + Intergenic
1036521654 8:9497265-9497287 GAGAAGTATTTCCAGTGGGTTGG + Intergenic
1041135353 8:54752223-54752245 GATTAATATTTGAAGTGTTTTGG - Intergenic
1042203151 8:66301671-66301693 GAGGAAATTTTGAAATGGGTTGG - Intergenic
1043467433 8:80526005-80526027 TAGTAACATTTGCAGTAGGTTGG - Exonic
1043641798 8:82461282-82461304 AAGTAATATTTGAAATCAGTAGG - Intergenic
1043919641 8:85966257-85966279 GAGTAATAAATTCAGTGGGTGGG - Intergenic
1046146026 8:110159657-110159679 GAAGAATATTTGAAATGGTTAGG - Intergenic
1047049766 8:121097842-121097864 AAGTAATAAATGAAGTAGGTTGG + Intergenic
1048347981 8:133592344-133592366 GAGAAAGATTTGAAGTGGAGAGG - Intergenic
1050882298 9:10717736-10717758 GAGTATTATTTGTAGTATGTGGG + Intergenic
1051318603 9:15873356-15873378 AAGTTATATTTGAAGTTGCTTGG + Intronic
1053565055 9:39241059-39241081 GAGTGATTATGGAAGTGGGTAGG - Intronic
1054132095 9:61377979-61378001 GAGTGATTATGGAAGTGGGTAGG + Intergenic
1055084595 9:72301158-72301180 GAATAGTATTTGATATGGGTTGG + Intergenic
1058449545 9:105083318-105083340 CAGGAAAACTTGAAGTGGGTTGG + Intergenic
1060467670 9:123921627-123921649 GAGTAAGACTTGAAGTGGGCTGG - Intronic
1185523079 X:756322-756344 GAGGAATATATGAAGTGAGGAGG + Intergenic
1186423883 X:9448379-9448401 GATTAGTGTTTGTAGTGGGTTGG + Intergenic
1186435002 X:9535147-9535169 GAGTAAGAATTCAAGTGGGATGG - Intronic
1187123841 X:16434853-16434875 CAATAATATCTGAAATGGGTAGG - Intergenic
1187291061 X:17953498-17953520 TAGCCATATTTGAAGTGGCTAGG - Intergenic
1188704395 X:33307865-33307887 GAGTAACTTTTGAAGGAGGTAGG - Intronic
1188910043 X:35835820-35835842 GAGTCATATTTGAAGTGCACAGG + Intergenic
1189317415 X:40065857-40065879 GAGTAATATTTGAAGTGGGTTGG - Intronic
1190585007 X:51931235-51931257 GGGAAATATTTGAAGTAGGGAGG + Intergenic
1191606925 X:63072265-63072287 TAGCAATAGCTGAAGTGGGTGGG + Intergenic
1193681714 X:84528096-84528118 GAGTAATAATGAATGTGGGTTGG + Intergenic
1197449749 X:126597338-126597360 GAGTAATATTTCAAGAAGGCTGG - Intergenic
1198729100 X:139708063-139708085 GAGTAATATAAGAAATGGATTGG - Intronic