ID: 1189317419

View in Genome Browser
Species Human (GRCh38)
Location X:40065880-40065902
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189317419_1189317422 -9 Left 1189317419 X:40065880-40065902 CCACTCCTGACCAGCACCGCTCA No data
Right 1189317422 X:40065894-40065916 CACCGCTCACCCGCTTCTCTCGG No data
1189317419_1189317435 29 Left 1189317419 X:40065880-40065902 CCACTCCTGACCAGCACCGCTCA No data
Right 1189317435 X:40065932-40065954 TTCACGGCAGTCAGCTGTGGGGG No data
1189317419_1189317430 13 Left 1189317419 X:40065880-40065902 CCACTCCTGACCAGCACCGCTCA No data
Right 1189317430 X:40065916-40065938 GGGGCATTGCCAGCGGTTCACGG No data
1189317419_1189317426 -6 Left 1189317419 X:40065880-40065902 CCACTCCTGACCAGCACCGCTCA No data
Right 1189317426 X:40065897-40065919 CGCTCACCCGCTTCTCTCGGGGG No data
1189317419_1189317432 26 Left 1189317419 X:40065880-40065902 CCACTCCTGACCAGCACCGCTCA No data
Right 1189317432 X:40065929-40065951 CGGTTCACGGCAGTCAGCTGTGG No data
1189317419_1189317423 -8 Left 1189317419 X:40065880-40065902 CCACTCCTGACCAGCACCGCTCA No data
Right 1189317423 X:40065895-40065917 ACCGCTCACCCGCTTCTCTCGGG No data
1189317419_1189317429 6 Left 1189317419 X:40065880-40065902 CCACTCCTGACCAGCACCGCTCA No data
Right 1189317429 X:40065909-40065931 TCTCTCGGGGGCATTGCCAGCGG No data
1189317419_1189317425 -7 Left 1189317419 X:40065880-40065902 CCACTCCTGACCAGCACCGCTCA No data
Right 1189317425 X:40065896-40065918 CCGCTCACCCGCTTCTCTCGGGG No data
1189317419_1189317434 28 Left 1189317419 X:40065880-40065902 CCACTCCTGACCAGCACCGCTCA No data
Right 1189317434 X:40065931-40065953 GTTCACGGCAGTCAGCTGTGGGG No data
1189317419_1189317433 27 Left 1189317419 X:40065880-40065902 CCACTCCTGACCAGCACCGCTCA No data
Right 1189317433 X:40065930-40065952 GGTTCACGGCAGTCAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189317419 Original CRISPR TGAGCGGTGCTGGTCAGGAG TGG (reversed) Intronic