ID: 1189317425

View in Genome Browser
Species Human (GRCh38)
Location X:40065896-40065918
Sequence CCGCTCACCCGCTTCTCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189317417_1189317425 11 Left 1189317417 X:40065862-40065884 CCACTTCAAATATTACTCCCACT No data
Right 1189317425 X:40065896-40065918 CCGCTCACCCGCTTCTCTCGGGG No data
1189317415_1189317425 16 Left 1189317415 X:40065857-40065879 CCAACCCACTTCAAATATTACTC No data
Right 1189317425 X:40065896-40065918 CCGCTCACCCGCTTCTCTCGGGG No data
1189317419_1189317425 -7 Left 1189317419 X:40065880-40065902 CCACTCCTGACCAGCACCGCTCA No data
Right 1189317425 X:40065896-40065918 CCGCTCACCCGCTTCTCTCGGGG No data
1189317418_1189317425 -6 Left 1189317418 X:40065879-40065901 CCCACTCCTGACCAGCACCGCTC No data
Right 1189317425 X:40065896-40065918 CCGCTCACCCGCTTCTCTCGGGG No data
1189317412_1189317425 23 Left 1189317412 X:40065850-40065872 CCTCTCCCCAACCCACTTCAAAT No data
Right 1189317425 X:40065896-40065918 CCGCTCACCCGCTTCTCTCGGGG No data
1189317413_1189317425 18 Left 1189317413 X:40065855-40065877 CCCCAACCCACTTCAAATATTAC No data
Right 1189317425 X:40065896-40065918 CCGCTCACCCGCTTCTCTCGGGG No data
1189317416_1189317425 12 Left 1189317416 X:40065861-40065883 CCCACTTCAAATATTACTCCCAC No data
Right 1189317425 X:40065896-40065918 CCGCTCACCCGCTTCTCTCGGGG No data
1189317414_1189317425 17 Left 1189317414 X:40065856-40065878 CCCAACCCACTTCAAATATTACT No data
Right 1189317425 X:40065896-40065918 CCGCTCACCCGCTTCTCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189317425 Original CRISPR CCGCTCACCCGCTTCTCTCG GGG Intronic