ID: 1189317429

View in Genome Browser
Species Human (GRCh38)
Location X:40065909-40065931
Sequence TCTCTCGGGGGCATTGCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189317418_1189317429 7 Left 1189317418 X:40065879-40065901 CCCACTCCTGACCAGCACCGCTC No data
Right 1189317429 X:40065909-40065931 TCTCTCGGGGGCATTGCCAGCGG No data
1189317420_1189317429 1 Left 1189317420 X:40065885-40065907 CCTGACCAGCACCGCTCACCCGC No data
Right 1189317429 X:40065909-40065931 TCTCTCGGGGGCATTGCCAGCGG No data
1189317417_1189317429 24 Left 1189317417 X:40065862-40065884 CCACTTCAAATATTACTCCCACT No data
Right 1189317429 X:40065909-40065931 TCTCTCGGGGGCATTGCCAGCGG No data
1189317421_1189317429 -4 Left 1189317421 X:40065890-40065912 CCAGCACCGCTCACCCGCTTCTC No data
Right 1189317429 X:40065909-40065931 TCTCTCGGGGGCATTGCCAGCGG No data
1189317424_1189317429 -10 Left 1189317424 X:40065896-40065918 CCGCTCACCCGCTTCTCTCGGGG No data
Right 1189317429 X:40065909-40065931 TCTCTCGGGGGCATTGCCAGCGG No data
1189317414_1189317429 30 Left 1189317414 X:40065856-40065878 CCCAACCCACTTCAAATATTACT No data
Right 1189317429 X:40065909-40065931 TCTCTCGGGGGCATTGCCAGCGG No data
1189317415_1189317429 29 Left 1189317415 X:40065857-40065879 CCAACCCACTTCAAATATTACTC No data
Right 1189317429 X:40065909-40065931 TCTCTCGGGGGCATTGCCAGCGG No data
1189317416_1189317429 25 Left 1189317416 X:40065861-40065883 CCCACTTCAAATATTACTCCCAC No data
Right 1189317429 X:40065909-40065931 TCTCTCGGGGGCATTGCCAGCGG No data
1189317419_1189317429 6 Left 1189317419 X:40065880-40065902 CCACTCCTGACCAGCACCGCTCA No data
Right 1189317429 X:40065909-40065931 TCTCTCGGGGGCATTGCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189317429 Original CRISPR TCTCTCGGGGGCATTGCCAG CGG Intronic