ID: 1189319989

View in Genome Browser
Species Human (GRCh38)
Location X:40082166-40082188
Sequence TCACATCTTTTCACAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189319989_1189319995 4 Left 1189319989 X:40082166-40082188 CCACCCTCTGTGAAAAGATGTGA 0: 1
1: 0
2: 2
3: 17
4: 185
Right 1189319995 X:40082193-40082215 AGACCACAGGTCCCAAGCCTTGG 0: 1
1: 0
2: 0
3: 16
4: 290
1189319989_1189319994 -9 Left 1189319989 X:40082166-40082188 CCACCCTCTGTGAAAAGATGTGA 0: 1
1: 0
2: 2
3: 17
4: 185
Right 1189319994 X:40082180-40082202 AAGATGTGAGGGCAGACCACAGG 0: 1
1: 0
2: 0
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189319989 Original CRISPR TCACATCTTTTCACAGAGGG TGG (reversed) Intronic
900461443 1:2803928-2803950 TCAGAGCTCTTCCCAGAGGGTGG - Intergenic
903973110 1:27132015-27132037 TCACAACTATTCAAAGAGGTAGG + Intronic
905942058 1:41871608-41871630 GAACATGTTTCCACAGAGGGTGG + Intronic
911769522 1:101722568-101722590 TCTCCTCTTTTCACAGATTGTGG + Intergenic
914519341 1:148401637-148401659 TCACCTCTTGTCACCCAGGGTGG - Intergenic
915542806 1:156579461-156579483 TCCCCTCATTTCACAGAGGAAGG - Intergenic
918341730 1:183573354-183573376 TTGCATCTATTCACTGAGGGAGG - Intronic
920390678 1:205598602-205598624 TCACATCATTTCAATGAGGAGGG - Intronic
921328682 1:214013898-214013920 TCCCTTCTTTTCACTGAAGGAGG - Intronic
921665811 1:217869454-217869476 TCACATCTTTTCACTGATCCAGG - Exonic
922494446 1:226045034-226045056 TCACATGGTTTCACAGAGTCTGG + Intergenic
923767007 1:236901695-236901717 TCTCATGTTCTCACAGTGGGTGG + Exonic
924025629 1:239830307-239830329 ACACATATTTTGACTGAGGGTGG - Intronic
1066333067 10:34446133-34446155 CCACATCCTTGCACAGAGGAAGG - Intronic
1067854994 10:49784401-49784423 TCAGGTCTGCTCACAGAGGGTGG + Intergenic
1069811158 10:71160786-71160808 GCTCATGTTTTCACAGAAGGTGG - Intergenic
1070116631 10:73535005-73535027 TCACAGTTTTTCACAGTGGCAGG - Intronic
1072270194 10:93768752-93768774 TCACATCTTTTGTCAGTGGTGGG - Intronic
1073672279 10:105605643-105605665 TCACATCTAATCACAGACTGAGG - Intergenic
1074396158 10:113099619-113099641 TCTCATCATTTCCCAGGGGGAGG - Intronic
1074970632 10:118533655-118533677 TCCCCTCATTTTACAGAGGGGGG - Intergenic
1077200529 11:1305138-1305160 TCACATCTTTTCACTGTGTGGGG - Intronic
1078648687 11:13167029-13167051 TCAAATCTTTTCACAGAGTTAGG + Intergenic
1078675830 11:13412870-13412892 TCACATCTTTTCTCAGGGTTGGG + Intronic
1079574470 11:21986269-21986291 TCACATCTGTTCACAGATGATGG + Intergenic
1079582858 11:22087792-22087814 TCACATCCTCTGACAGAGAGTGG + Intergenic
1079731458 11:23940659-23940681 TCACCTCTTTTCTCTGAGGTTGG - Intergenic
1080733531 11:34985954-34985976 GCAAATCTTTTCAAAGAGGAGGG - Intronic
1080814944 11:35746373-35746395 TCACATTTTTTCCCAGTGAGAGG + Intronic
1082976653 11:59079329-59079351 TCACATCTGGACACTGAGGGAGG - Intergenic
1088616179 11:111631094-111631116 GCACACCTTTTCAGAGAAGGAGG - Intronic
1089711601 11:120318843-120318865 TCAAATCTTTTCACAGATTTTGG - Exonic
1089817718 11:121191169-121191191 TCACAGTTTTTTACAGAGAGAGG + Exonic
1090013586 11:123065453-123065475 TCTCATTTTTTCAGAGATGGGGG - Intergenic
1091269056 11:134292905-134292927 TCACTTCTCTGCACAGAGTGTGG + Intronic
1091285377 11:134405764-134405786 TCCCTTCTTTTCACAGATGAGGG - Intronic
1093639157 12:21505081-21505103 TTACATCTTTTTAAAGATGGAGG - Intronic
1093765382 12:22955747-22955769 TCACATCTTCACACAGATGTTGG - Intergenic
1093899822 12:24619078-24619100 GAACATCTTTTCACAGAGTTTGG + Intergenic
1096002180 12:48139275-48139297 TCACATCTTTGGTCTGAGGGGGG - Exonic
1099684482 12:85867099-85867121 TCACTTCTTTTCTCAGGGGAAGG - Intergenic
1102017387 12:109656855-109656877 TTGCATCTTTTATCAGAGGGAGG + Intergenic
1103347741 12:120262566-120262588 TCACAACCTTTCAGAAAGGGAGG - Intronic
1104640439 12:130463536-130463558 TCACCCCTCTTCACAGAGGCCGG - Intronic
1105928296 13:25028325-25028347 ACATATCTTCTCACAGAGAGCGG - Intergenic
1106292389 13:28376506-28376528 TCAAATATTTCCAGAGAGGGAGG + Intronic
1107774356 13:43822676-43822698 TCCCTCCTTTTCACAGAGAGAGG + Intergenic
1108288890 13:48937628-48937650 TCTCTTCATTTTACAGAGGGTGG + Intergenic
1109068812 13:57736642-57736664 TCAGATACTTTCACAAAGGGAGG + Intergenic
1109419238 13:62088895-62088917 TCACATTATTTTACAGAGGATGG + Intergenic
1109488268 13:63057216-63057238 GCACATCTTCCCACAGAGGCAGG - Intergenic
1110430690 13:75419638-75419660 TTACATTCTTCCACAGAGGGAGG + Intronic
1111534577 13:89586245-89586267 TCTCATCCTCTCACAGAGGCTGG - Intergenic
1112245326 13:97728266-97728288 TCACATCTGTTCACAGTGTATGG - Intergenic
1112801329 13:103113065-103113087 TCAAATCTTTTAACAGAGTTTGG - Intergenic
1114474923 14:22987565-22987587 TCACATCATTCCACAGACGTTGG + Exonic
1114487668 14:23072863-23072885 ACACAACTTTTAACAGAGTGGGG - Intronic
1114894148 14:26964904-26964926 TCTCATCTTGTCACTGATGGAGG + Intergenic
1120359446 14:83479118-83479140 TTCCATCTTTTCACAGAAGTAGG - Intergenic
1121326730 14:93024473-93024495 TCAGCTCTAGTCACAGAGGGAGG - Intronic
1125524190 15:40364963-40364985 TCTCATCTTTTCACTGTGGGTGG + Intronic
1128400929 15:67280249-67280271 TCACATTTTTTAACAGAGCCAGG + Intronic
1128912010 15:71524119-71524141 TATTATCTTTTCTCAGAGGGTGG - Intronic
1130302118 15:82688386-82688408 TCACACCTTTACACAAAGGGGGG + Intronic
1130347061 15:83057338-83057360 TCTCATCTTTTTAGAGAGGCAGG - Intronic
1130554185 15:84911229-84911251 ACACATCCTTCCAGAGAGGGAGG - Intronic
1131402299 15:92134942-92134964 TTACATCTTTTCAGAGATGGGGG - Intronic
1132033992 15:98464842-98464864 TCACATCATATCAGAGAGGTAGG - Intronic
1134318643 16:13142722-13142744 TCTCATTATTTCACAGAGTGGGG + Intronic
1135605882 16:23824242-23824264 TGGCATCTTTTCACAGATGTGGG + Intergenic
1139251845 16:65504309-65504331 TAACATTTTTTAAAAGAGGGGGG - Intergenic
1140565790 16:76040487-76040509 TCATATGTTTTCACCGAGGGAGG - Intergenic
1141640732 16:85339520-85339542 TCAGATCTTTTCAGGGAAGGCGG + Intergenic
1142625616 17:1190042-1190064 TTGCATCTTTCCAGAGAGGGTGG - Intronic
1144506546 17:15836247-15836269 CCACCTCTTTTAACAGAGGCAGG - Intergenic
1145170720 17:20654179-20654201 CCACCTCTTTTAACAGAGGCAGG - Intergenic
1145354539 17:22129973-22129995 GCACATCTTCCCACAGAGGCAGG + Intergenic
1147189042 17:38728461-38728483 TCACACCTCCTCACTGAGGGTGG - Exonic
1147189053 17:38728512-38728534 TCACACCTCCTCACTGAGGGTGG - Exonic
1154291669 18:13113593-13113615 TCACATTTTTGCCCAGAGGTAGG + Exonic
1156946976 18:42844864-42844886 TCACTACTTTTGATAGAGGGTGG - Intronic
1158556924 18:58483033-58483055 TCACAGCTCCTCACAGAGTGTGG + Intronic
1160927825 19:1555556-1555578 TCATATCTTTTCCTAGAGCGCGG - Exonic
1162772872 19:12960441-12960463 TTACATCTTCTCACAGAAGATGG + Intergenic
1165341411 19:35214676-35214698 TACCTTCATTTCACAGAGGGGGG - Intergenic
1167033815 19:46981099-46981121 TCATACCTTTCCACAGAGGTCGG + Intronic
925308025 2:2863939-2863961 TCACATCATTGTACAGATGGAGG + Intergenic
932821912 2:74908851-74908873 TCACCTGTTTTCACTTAGGGCGG - Intergenic
934544363 2:95202559-95202581 TCACATCTTGTCCCAGTGGAAGG - Intergenic
934564700 2:95331825-95331847 TCAGATATTTTGACAGTGGGAGG + Intronic
934777932 2:96950695-96950717 TGACACCTTTGCACAGAGAGAGG - Intronic
935789488 2:106577828-106577850 TCTCCTCTTTCTACAGAGGGAGG + Intergenic
936529579 2:113266539-113266561 TCTCATCATTTCACAGAGTGGGG + Intronic
937713335 2:125003627-125003649 TCACATATTTTAACAGAGAGAGG - Intergenic
939464139 2:142535522-142535544 TCACATCTTGTCCCAGTGGAAGG - Intergenic
939787405 2:146534314-146534336 TCAAATTTTTTCTCAGAGGCAGG - Intergenic
940091803 2:149928225-149928247 TCACCTCTTTTCAGAGTGAGAGG + Intergenic
942970407 2:181951308-181951330 TCACATTTTATCACTGATGGAGG + Intergenic
943571890 2:189582991-189583013 TCAAATGTTTTCTCAGAAGGAGG - Intronic
945060243 2:205902578-205902600 TGACATCATCTCACAGAAGGCGG - Intergenic
945949783 2:216027829-216027851 TGACTTTTTATCACAGAGGGTGG - Intronic
947814076 2:233024221-233024243 TCACATCCTATCACAGATGCGGG - Intergenic
1170390314 20:15866029-15866051 TCACAACTGATCACACAGGGAGG + Intronic
1171173443 20:23034939-23034961 GCACATCTTTACCCAAAGGGAGG + Intergenic
1172165884 20:32898913-32898935 TCACACCCTTTCACAGATGAGGG - Intronic
1172738691 20:37148908-37148930 TCACATGTTTTCACATATTGTGG - Intronic
1178464818 21:32838127-32838149 TCATATTTTTTCATAGAGGTGGG - Intergenic
1179803138 21:43821137-43821159 TCACTTCTTTTCAAAAAGAGAGG - Intergenic
1180153137 21:45962697-45962719 TCACATCTTGTGCAAGAGGGAGG - Intergenic
1180854713 22:19038688-19038710 TCACTTCTTTTGGCAGAAGGCGG + Exonic
1183747466 22:39699866-39699888 TGACATGTTTGCACAGTGGGTGG + Intergenic
1183834008 22:40437077-40437099 TCCCATCTTCTAACAGAAGGGGG + Intronic
949768641 3:7554049-7554071 TCATAGCTTTGCACAGAGGGTGG - Intronic
954241613 3:49298273-49298295 TCAGATCTGTGCACTGAGGGTGG - Intronic
954692542 3:52403292-52403314 TGACCTCTCTTCCCAGAGGGTGG - Exonic
955075749 3:55611491-55611513 CCAAATCTTTTCACACAGTGAGG - Intronic
955370888 3:58350767-58350789 ACACATATCTTCAGAGAGGGAGG - Intronic
956216464 3:66854648-66854670 TCTCATCCTTTCACAGTGGGTGG - Intergenic
956659994 3:71587928-71587950 TCACATCTATGGAGAGAGGGTGG - Intergenic
957090427 3:75724324-75724346 TCTCATCTCTGCACACAGGGAGG + Intronic
957319499 3:78611249-78611271 TAACATCATTCCAAAGAGGGTGG + Intronic
957588112 3:82158717-82158739 TCACAACTTATCAGTGAGGGAGG + Intergenic
960529154 3:118743854-118743876 TGACATCTTTTCCTACAGGGAGG - Intergenic
963361306 3:144275270-144275292 TCACATCTATTTGAAGAGGGTGG + Intergenic
964466759 3:157001329-157001351 TCACTTCTTTTAACAGAGGCAGG + Intronic
973792866 4:54394637-54394659 TCACCACTGTTCAGAGAGGGAGG - Intergenic
974671279 4:65033297-65033319 TCACATTTTTTCAGAGATGGAGG - Intergenic
976130773 4:81881822-81881844 TTAAATCTGATCACAGAGGGCGG - Intronic
977182952 4:93899930-93899952 TCAAGTCTTTTCACACTGGGAGG + Intergenic
978345927 4:107769173-107769195 TCTCATATTTTCACAAATGGTGG - Intergenic
983043661 4:162959390-162959412 TGACATGTTTTCCCAGAGGTTGG - Intergenic
984388537 4:179097053-179097075 TCATGTCTTTTCTCATAGGGAGG - Intergenic
984895765 4:184538087-184538109 AGACCTCGTTTCACAGAGGGAGG + Intergenic
985334725 4:188879460-188879482 TCACAATTTTTCACTTAGGGAGG - Intergenic
985733618 5:1565109-1565131 TCAGAGCCTTGCACAGAGGGCGG - Intergenic
986826591 5:11528954-11528976 TCTGATCTTCTCACAGAGGCCGG + Intronic
987789495 5:22546515-22546537 TCACAGCATTTTACAGAGAGGGG - Intronic
987934987 5:24451858-24451880 TCAAAACTTTTGCCAGAGGGAGG + Intergenic
988352197 5:30123721-30123743 AAACATTTTTTCAAAGAGGGTGG + Intergenic
989987253 5:50715301-50715323 ACACATATTTTGACAGAGTGTGG - Intronic
991307323 5:65191967-65191989 TCCCATCATTTCACAGACTGAGG - Intronic
991462070 5:66869746-66869768 TCAGATCTCTTAACAGAGGAGGG - Intronic
992645229 5:78805533-78805555 TCACTGCTTTCCACAGAGGTAGG + Intronic
993504705 5:88694797-88694819 ACACAACTTTTCAATGAGGGAGG + Intergenic
993671541 5:90766628-90766650 TCACTTCTTATCACTGTGGGAGG - Intronic
995758358 5:115537067-115537089 TCACAGCTCTTCCCAAAGGGAGG + Intronic
999228142 5:150044525-150044547 TCACAACTTTTTACAGTGGAGGG + Intronic
1000020067 5:157311015-157311037 TGACATCTTTTCACAAGGCGTGG + Intronic
1000179866 5:158798466-158798488 TCTCATCATTGCACAAAGGGAGG + Intronic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1002848254 6:968016-968038 TCACATTTCTTCCAAGAGGGAGG + Intergenic
1005124992 6:22436831-22436853 TCACATCTTGTCCCACTGGGAGG + Intergenic
1005909045 6:30292167-30292189 TCACCTCTTTTCAGGCAGGGTGG - Intergenic
1010124415 6:72415312-72415334 TGCCATCTTTTCTTAGAGGGGGG + Intergenic
1010846780 6:80719545-80719567 ACACATATTTCCACAAAGGGAGG - Intergenic
1011051792 6:83159301-83159323 TCTCATCTTTTCACCCAGGCTGG + Intronic
1011578797 6:88833731-88833753 TAACATCTTTTGACAGAGCATGG + Intronic
1013813984 6:114075792-114075814 TCACATCTTCTTACAGAGCTGGG + Intronic
1014141014 6:117942111-117942133 TCACATCTTTTTACAGACATTGG + Intronic
1014165228 6:118216903-118216925 TCACCCCTTTTCACATAGAGTGG + Intronic
1015696220 6:135982831-135982853 TCACACCCTGTCACAGAGTGAGG + Intronic
1016303422 6:142656940-142656962 TGACATCTTTTCACAAAAGCCGG + Intergenic
1018501807 6:164419309-164419331 TCACATATTGACTCAGAGGGAGG + Intergenic
1021464090 7:20922141-20922163 TCTCATCTTTTCCTACAGGGTGG + Intergenic
1021696552 7:23281868-23281890 CCACATCTTGTCCCAGTGGGTGG - Intergenic
1023527927 7:41124273-41124295 TCACATCTTGTCCCACTGGGAGG - Intergenic
1023837523 7:44077090-44077112 ACATATCTTCCCACAGAGGGTGG + Intronic
1024375860 7:48637189-48637211 TGCCATCTTTGCACAGATGGTGG + Intronic
1024974366 7:55099799-55099821 GCACATCTGTTCACAGAGGTTGG - Intronic
1033790544 7:144788243-144788265 GTACAACTTTTGACAGAGGGAGG + Intronic
1034678678 7:152911278-152911300 TCATCACTTTTCACAGAGGAAGG - Intergenic
1034692531 7:153025256-153025278 TCACATGTTGTCACTGAAGGTGG + Intergenic
1035871128 8:3137121-3137143 TCCCATCATTTCACAGAGCCAGG - Intronic
1038710159 8:29936350-29936372 TCACATCTTGTCCCACTGGGAGG - Intergenic
1039417393 8:37407391-37407413 TCACACCTTTGCACAGAGGGAGG - Intergenic
1039904266 8:41774663-41774685 TCACATCTTTCTGCTGAGGGTGG + Intronic
1040552306 8:48446912-48446934 TCACAACTTTTCAAAAAGTGTGG - Intergenic
1041846835 8:62338995-62339017 TCACAGCTCTTGACACAGGGTGG + Intronic
1041876223 8:62690404-62690426 TCACATGTATTCACAGAGGGAGG - Intronic
1043342914 8:79263069-79263091 TTACTTCTTTTCACAGTGAGGGG - Intergenic
1043553574 8:81403267-81403289 TCACATCTTATCTCAAAGTGGGG + Intergenic
1044606158 8:94049819-94049841 TCACATCTTTATAGAGAGGAGGG + Intergenic
1044618974 8:94170587-94170609 TCTCTGCTTTTGACAGAGGGTGG - Intronic
1045182555 8:99801195-99801217 TCAAATCTTGAGACAGAGGGTGG - Intronic
1045696927 8:104819623-104819645 TGACAACTTGTCACAGAGGAAGG + Intronic
1046414833 8:113899165-113899187 TCATTTATTTTCACAGAAGGGGG + Intergenic
1046580124 8:116082202-116082224 CTACATCTTTAAACAGAGGGAGG + Intergenic
1046992813 8:120479070-120479092 TCACATTTTCTCACAAATGGAGG + Intronic
1049158253 8:141080536-141080558 TCACATCCTTTCTCAGATGCAGG + Intergenic
1054483244 9:65690138-65690160 CCACATCTTTTCAGAGCAGGTGG + Intronic
1057934824 9:99228189-99228211 TGACATCTTTTCATGGAGTGAGG + Intronic
1058603349 9:106694985-106695007 TCACATTTATTCATAGAGGGCGG - Intergenic
1060641982 9:125246545-125246567 TTAAATATTTTCACAGAAGGAGG - Intergenic
1061931762 9:133836658-133836680 TCAAATCTGATCACAGAGTGTGG + Intronic
1185525925 X:778674-778696 TCACGTCTATGCACAGATGGGGG - Intergenic
1185810462 X:3104293-3104315 TCACATCTTCTCACTCAGTGTGG - Intronic
1189109943 X:38278755-38278777 GCCCCTCTTTTCACAGAGGGAGG + Intronic
1189319989 X:40082166-40082188 TCACATCTTTTCACAGAGGGTGG - Intronic
1191127189 X:56970130-56970152 TCACATCTTTTCTCACTGGGAGG + Intergenic
1194743773 X:97606583-97606605 TGACATCTTTTTGAAGAGGGAGG + Intergenic
1194746723 X:97636391-97636413 TCACATCCTAACAAAGAGGGAGG - Intergenic
1195232545 X:102865276-102865298 TGACATCCTATCACATAGGGTGG + Intergenic
1195529765 X:105940641-105940663 TTACATCCTTTCACAGTGGATGG - Intronic
1197900260 X:131364114-131364136 CCACATCAATTCACAGATGGAGG + Intronic
1200967062 Y:9057272-9057294 TCACATCTATTCACAGATTCTGG + Intergenic