ID: 1189320893

View in Genome Browser
Species Human (GRCh38)
Location X:40086534-40086556
Sequence AGTCATAAAGATGTGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 217}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189320877_1189320893 27 Left 1189320877 X:40086484-40086506 CCCTAAACCACAACATACAAACC 0: 2
1: 0
2: 2
3: 17
4: 236
Right 1189320893 X:40086534-40086556 AGTCATAAAGATGTGTGTTGGGG 0: 1
1: 0
2: 0
3: 22
4: 217
1189320885_1189320893 -5 Left 1189320885 X:40086516-40086538 CCCACCCCAATCCTGGGAAGTCA 0: 1
1: 0
2: 1
3: 22
4: 207
Right 1189320893 X:40086534-40086556 AGTCATAAAGATGTGTGTTGGGG 0: 1
1: 0
2: 0
3: 22
4: 217
1189320888_1189320893 -10 Left 1189320888 X:40086521-40086543 CCCAATCCTGGGAAGTCATAAAG 0: 1
1: 0
2: 1
3: 9
4: 148
Right 1189320893 X:40086534-40086556 AGTCATAAAGATGTGTGTTGGGG 0: 1
1: 0
2: 0
3: 22
4: 217
1189320881_1189320893 2 Left 1189320881 X:40086509-40086531 CCTGCACCCCACCCCAATCCTGG 0: 1
1: 0
2: 9
3: 73
4: 745
Right 1189320893 X:40086534-40086556 AGTCATAAAGATGTGTGTTGGGG 0: 1
1: 0
2: 0
3: 22
4: 217
1189320879_1189320893 20 Left 1189320879 X:40086491-40086513 CCACAACATACAAACCATCCTGC 0: 2
1: 0
2: 1
3: 14
4: 165
Right 1189320893 X:40086534-40086556 AGTCATAAAGATGTGTGTTGGGG 0: 1
1: 0
2: 0
3: 22
4: 217
1189320886_1189320893 -6 Left 1189320886 X:40086517-40086539 CCACCCCAATCCTGGGAAGTCAT 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1189320893 X:40086534-40086556 AGTCATAAAGATGTGTGTTGGGG 0: 1
1: 0
2: 0
3: 22
4: 217
1189320884_1189320893 -4 Left 1189320884 X:40086515-40086537 CCCCACCCCAATCCTGGGAAGTC 0: 1
1: 0
2: 1
3: 28
4: 306
Right 1189320893 X:40086534-40086556 AGTCATAAAGATGTGTGTTGGGG 0: 1
1: 0
2: 0
3: 22
4: 217
1189320887_1189320893 -9 Left 1189320887 X:40086520-40086542 CCCCAATCCTGGGAAGTCATAAA 0: 1
1: 0
2: 1
3: 14
4: 170
Right 1189320893 X:40086534-40086556 AGTCATAAAGATGTGTGTTGGGG 0: 1
1: 0
2: 0
3: 22
4: 217
1189320878_1189320893 26 Left 1189320878 X:40086485-40086507 CCTAAACCACAACATACAAACCA 0: 2
1: 0
2: 1
3: 64
4: 497
Right 1189320893 X:40086534-40086556 AGTCATAAAGATGTGTGTTGGGG 0: 1
1: 0
2: 0
3: 22
4: 217
1189320880_1189320893 6 Left 1189320880 X:40086505-40086527 CCATCCTGCACCCCACCCCAATC 0: 1
1: 1
2: 14
3: 95
4: 819
Right 1189320893 X:40086534-40086556 AGTCATAAAGATGTGTGTTGGGG 0: 1
1: 0
2: 0
3: 22
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189320893 Original CRISPR AGTCATAAAGATGTGTGTTG GGG Intronic
901488467 1:9582224-9582246 AGTTTTAAAGTTGTGTGCTGTGG + Intronic
904043132 1:27595509-27595531 GGTCATAAAAATGTGGGTTTTGG + Intronic
904604213 1:31690145-31690167 ATTCATAACCATGTGTGTGGTGG + Intronic
904616331 1:31752227-31752249 AGACATGAAGATGTGTGTGAGGG + Intronic
904915447 1:33967103-33967125 GGTCATAATGATGTGGGGTGAGG + Intronic
907059764 1:51409546-51409568 AGTCAGAAAGAAATGTGCTGAGG - Exonic
910951573 1:92653746-92653768 AGCCAAAAAGCTGTGTGTTTTGG + Intronic
911839631 1:102664156-102664178 AGTCATAATGATCTGTGATAAGG - Intergenic
913552817 1:119933291-119933313 AGTCATCACAATGTGTGTTTTGG - Intronic
917905565 1:179584512-179584534 AGACATAAAGCTGTGTTTTGTGG - Intergenic
919975430 1:202607801-202607823 AGGGATAAAGATGTGTGTCCAGG + Intronic
920618080 1:207514328-207514350 ATTCACAAAGTTGTGTGTTATGG + Intronic
923540550 1:234885341-234885363 AGTCATAGACATTTGTTTTGTGG - Intergenic
923683774 1:236140664-236140686 ACACATAAATAAGTGTGTTGCGG + Intergenic
1063544339 10:6965536-6965558 AGTCATAACGATGTGTAATCTGG - Intergenic
1064098778 10:12444999-12445021 TGTCAAAGAAATGTGTGTTGGGG + Intronic
1064759740 10:18605590-18605612 AAACATAAATATATGTGTTGTGG + Intronic
1066061094 10:31724159-31724181 AGTGAGAAAGATAAGTGTTGTGG - Intergenic
1066126971 10:32351187-32351209 AGTTATAAAGATATGACTTGGGG - Intronic
1066535538 10:36386878-36386900 AGACATAAACATTTGTGTTTTGG - Intergenic
1067143569 10:43676824-43676846 TGTCTCAAAGATGTGTGTAGTGG + Intergenic
1067461803 10:46463704-46463726 AGTCACAATGATGTATGTAGTGG - Intronic
1067625391 10:47920897-47920919 AGTCACAATGATGTATGTAGTGG + Intergenic
1068756331 10:60658475-60658497 AGTTCTAAGGATGTGTGTGGGGG - Intronic
1072309629 10:94141774-94141796 AGTCAGAAAGATGACTGGTGAGG + Intronic
1072673349 10:97447581-97447603 ATTCAAAAAGATGTGTGTAGGGG - Intronic
1073355213 10:102848394-102848416 AGAGACAAAGAGGTGTGTTGTGG + Intergenic
1074739455 10:116470807-116470829 AGTCATAAAAATATTTGGTGTGG - Intronic
1076148521 10:128144528-128144550 AGTCAAAAAGTTGTGTTTTGTGG + Intergenic
1077322900 11:1950329-1950351 AGGCTCAAAGACGTGTGTTGGGG - Intronic
1078569384 11:12444321-12444343 GCCCATAAAGATGGGTGTTGAGG + Intronic
1079490633 11:20985507-20985529 AATCATAAAGCTGTGTGATGAGG + Intronic
1080112475 11:28583669-28583691 AGTCATCAACAGCTGTGTTGTGG + Intergenic
1080275723 11:30501494-30501516 AGGCAAAAAGTTGTGTGTTAAGG - Intronic
1080367257 11:31589826-31589848 ACTGATAAAGATGTTTTTTGTGG - Intronic
1082206654 11:49443696-49443718 AGGCATAAAAATAAGTGTTGTGG + Intergenic
1086648612 11:89258069-89258091 AGGCATAAAAATAAGTGTTGTGG - Intronic
1087427426 11:98008018-98008040 TGTCAGAAAGCTGTGGGTTGGGG - Intergenic
1089941052 11:122418094-122418116 ACACAGAAAGGTGTGTGTTGTGG - Intergenic
1202805918 11_KI270721v1_random:5642-5664 AGGCTCAAAGACGTGTGTTGGGG - Intergenic
1091704272 12:2683348-2683370 AGTCATAAAGATGTTTCTCAAGG - Intronic
1092776285 12:11947453-11947475 AGTCAGAAGGATGGGTGCTGTGG + Intergenic
1093894098 12:24557854-24557876 AGCCATAAAAATGTATCTTGGGG - Intergenic
1095288643 12:40447981-40448003 TATTATTAAGATGTGTGTTGTGG - Intronic
1097342802 12:58457991-58458013 ACTCACAAAAATGTGTGTGGAGG - Intergenic
1097524151 12:60709661-60709683 AGTCATAAAGATGCCTTCTGAGG - Intergenic
1098512758 12:71337805-71337827 ATTCAGAATGATGTTTGTTGTGG - Intronic
1098851297 12:75599656-75599678 AGTCATAAAGATAAATGTTTTGG + Intergenic
1099647887 12:85382581-85382603 AATTATAAAGATGTTTATTGCGG + Intergenic
1101696605 12:107133028-107133050 AGTTATAAATCTGAGTGTTGGGG - Intergenic
1101938992 12:109084974-109084996 ATTCATAAAAATCTGTGTTTTGG - Exonic
1102617783 12:114169604-114169626 AGTTATAAAGATGAGTGCTGGGG - Intergenic
1102845741 12:116180484-116180506 ATACATAATGATGTGTCTTGGGG - Intronic
1103052714 12:117795094-117795116 AGTCAGAATGATATGTCTTGGGG - Intronic
1103284521 12:119789137-119789159 AGTCAGAAAGATGTGGAGTGTGG + Intronic
1104758251 12:131282167-131282189 AGTCACAAAGCTGAGTGCTGGGG + Intergenic
1107183040 13:37484607-37484629 ACTCATACAGATGGGTATTGTGG - Intergenic
1108055904 13:46484928-46484950 AGTGATGGAGATGTGTGATGAGG - Intergenic
1108116768 13:47137328-47137350 AGGCATCAAGATGGGTGGTGGGG - Intergenic
1108990086 13:56644419-56644441 ATGCTTACAGATGTGTGTTGTGG + Intergenic
1109101828 13:58194848-58194870 AATAATAAAGAAGTCTGTTGGGG - Intergenic
1111019990 13:82437136-82437158 AATCCTAAAGATGTGTGATATGG + Intergenic
1115705167 14:35990776-35990798 AGCGATAAAGATGTGTGTGGAGG + Intergenic
1116121943 14:40731964-40731986 AGTGAGAAAGATGTGTCTTGTGG - Intergenic
1117624740 14:57623789-57623811 ACACATAAAGCTGTGTGTAGTGG + Intronic
1120001120 14:79304135-79304157 AGTCATAGAGATTGGTGGTGTGG + Intronic
1120491050 14:85179269-85179291 ACTAATAAATATGAGTGTTGGGG + Intergenic
1121463351 14:94098786-94098808 AATCATCAAGATGTGTGTATAGG - Intronic
1122336182 14:100987270-100987292 AATTATAAAAATGTGTGATGAGG + Intergenic
1122473864 14:101992007-101992029 ATTGATAAAGCTGTGTGGTGGGG - Intronic
1124915950 15:33974555-33974577 ATTCATCAACATGTGTGTTGGGG + Intronic
1126442325 15:48702916-48702938 AGAAATAAAGCTGTGTATTGGGG + Intergenic
1126923176 15:53550611-53550633 AGAGAAAAAGATGTGTGTTTTGG + Intronic
1127251232 15:57240578-57240600 AGTGGTAAAGAGGTATGTTGAGG + Intronic
1128475302 15:67992214-67992236 AGTCATATTTATGTTTGTTGTGG + Intergenic
1129088697 15:73125289-73125311 AGTCATAGAAATATGTTTTGTGG + Intronic
1130907477 15:88250813-88250835 AGTAATAAATATGAGTGTTTGGG - Intronic
1131101727 15:89696435-89696457 TGTCATAAACATTTGTGTAGAGG + Intronic
1131210251 15:90489023-90489045 AGTCATATAGGTGTGTGATAAGG + Intronic
1137902111 16:52279972-52279994 AGTGACAAAGATCTGTGCTGAGG - Intergenic
1138954752 16:61957688-61957710 AGTCCTAAGGATCTGTGTTATGG - Intronic
1139872360 16:70117803-70117825 AGTCATTAAGGTGGGTGTGGTGG + Intronic
1139963541 16:70731715-70731737 TGCCAAAAAGATGTGTGTGGGGG + Intronic
1140127120 16:72126815-72126837 AGTCAGAAAAATCTGGGTTGAGG + Intronic
1140363413 16:74363489-74363511 AGTCATTAAGGTGGGTGTGGTGG - Intergenic
1140666877 16:77235963-77235985 AGTGGTAAAGATTTGTGTAGGGG + Intergenic
1141371650 16:83492461-83492483 ACTCATAAATATTTCTGTTGGGG + Intronic
1145024194 17:19455505-19455527 ATTTATAAACATGTGTGATGAGG + Intergenic
1146431966 17:32805850-32805872 AGCCCTAAAGATGTGGCTTGAGG - Intronic
1149041258 17:52191655-52191677 AGTCTGAAACATGTGTGTTGAGG + Intergenic
1149408432 17:56378786-56378808 AGTGATTAAAATGTGTGATGGGG + Intronic
1149718028 17:58813023-58813045 AGTCATAATAATTTGTGATGTGG + Intronic
1155791990 18:29984219-29984241 AGTCATATAGATGTCTGGAGAGG - Intergenic
1156690441 18:39700731-39700753 AATCATATAGCTGAGTGTTGAGG + Intergenic
1156939888 18:42754440-42754462 AGGCATAAAAATATGTATTGAGG - Intronic
1159826660 18:73220829-73220851 ACACATAAAGATGTGTCGTGTGG + Intronic
1163502949 19:17687176-17687198 AGCCATAAAGGTGTGGGGTGGGG + Intronic
1165982549 19:39736997-39737019 ATTCATCAAGATGTTTGCTGAGG - Intronic
926179615 2:10630074-10630096 AGTCATTAAGCTGGGTGTGGTGG - Intronic
927875252 2:26650976-26650998 AGTCCAAAAGCTGTCTGTTGAGG + Intergenic
929258331 2:39838499-39838521 AGCCATAAAGATGTCTGTATTGG - Intergenic
929967712 2:46548011-46548033 ACTCAGGAGGATGTGTGTTGGGG + Intronic
929986746 2:46741622-46741644 TGTGATATAGATGTGTGTTGAGG + Intronic
930243029 2:48955748-48955770 AGTCCTGAAGATGTGAGTGGTGG - Intergenic
931630672 2:64295729-64295751 AATCAGAAAGCTGTGGGTTGGGG + Intergenic
931883342 2:66589624-66589646 AGTCATTAAGCAGTGTCTTGAGG + Intergenic
936171684 2:110182316-110182338 AATCATGATTATGTGTGTTGGGG - Intronic
939087430 2:137738309-137738331 AGTCATAAAGATGTTCACTGAGG - Intergenic
939272806 2:139961432-139961454 ATTAATAAAGATGTGCTTTGTGG + Intergenic
939726897 2:145731954-145731976 GTACATAAAAATGTGTGTTGGGG + Intergenic
939877456 2:147594071-147594093 AGTCCTAGAGATGTGAGATGAGG - Intergenic
940498729 2:154467332-154467354 AGTTATAAAGCTGTGTGCTCTGG + Intergenic
941504968 2:166331153-166331175 AGTCCTAAAGAAATGTGTTAAGG - Intronic
943703314 2:191010205-191010227 AGACATGAAGATGTGTTTCGTGG - Intronic
945767748 2:214000721-214000743 TGTGATAGTGATGTGTGTTGTGG + Intronic
946222728 2:218242455-218242477 AGTTGTAAAGATGTATTTTGAGG + Intronic
946712826 2:222523787-222523809 AATTTTAAAAATGTGTGTTGAGG + Intronic
947308565 2:228775108-228775130 ACTGGAAAAGATGTGTGTTGTGG + Intergenic
1169441623 20:5638531-5638553 TTTCATAGAGATGTGTGTGGTGG + Intergenic
1169691893 20:8341329-8341351 AGTTATAATGGAGTGTGTTGGGG - Intronic
1170058462 20:12233427-12233449 AATCATAAAGAGAGGTGTTGGGG - Intergenic
1170071469 20:12373865-12373887 AGTCATAAAGATGTAGGGGGAGG - Intergenic
1172033367 20:31996311-31996333 AGCCATGAAGAGGTGTGGTGAGG - Intronic
1172040226 20:32039436-32039458 AGTTAATAATATGTGTGTTGAGG + Intergenic
1173388620 20:42611505-42611527 AGGCATAAAGATGTGTTGTCAGG + Intronic
1174215910 20:48916200-48916222 AGGCATAAATATGGGTGATGTGG - Intergenic
1175142684 20:56872636-56872658 AGTCACAGAGATGTGGGTTGAGG + Intergenic
1175570747 20:60019866-60019888 ATTCATATAGATGGGTTTTGGGG + Intronic
1177463211 21:21440019-21440041 AGTCATAAAGTTCTGCGTTAGGG + Intronic
1177485927 21:21755983-21756005 TGTGTTAAAGATGTGTGTGGTGG - Intergenic
1177603149 21:23341992-23342014 AGTCATAATCATGTGTTTTCAGG + Intergenic
1180577149 22:16788084-16788106 ATTCATCAAGATGTGTTTTTTGG - Intronic
951059907 3:18193351-18193373 AGTCATGAATGTGTGTGTTGAGG + Intronic
952467443 3:33604790-33604812 GGTCACCATGATGTGTGTTGAGG - Intronic
954439864 3:50515969-50515991 GGTTATAAAAATGTGTGTTGAGG - Intergenic
955328945 3:58031110-58031132 AGTCATGAAGAGGTGTATAGGGG + Intronic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
956112158 3:65880554-65880576 TGTCATAAAGATATTTGTTTTGG - Intronic
956377862 3:68634994-68635016 AGTCATTAACATGTCTGTTCTGG + Intergenic
960076268 3:113489470-113489492 AGTTAGAAATAAGTGTGTTGAGG - Intronic
960188567 3:114674877-114674899 AGTCAAAAATATGGGTGTTCTGG + Intronic
963016076 3:140825297-140825319 AGTCATAAAGATCTGGGTATAGG - Intergenic
965475990 3:169155738-169155760 AGTGCTAAAGATTTGTGTAGAGG - Intronic
965546822 3:169924625-169924647 AGTGATAAATATGTGAGGTGAGG + Intronic
966200269 3:177354497-177354519 AGGCACAAAGGTGTGTGTTCAGG - Intergenic
966320654 3:178698060-178698082 AATCATGATTATGTGTGTTGGGG + Intronic
967158301 3:186713208-186713230 AATCAGAAAGAAGGGTGTTGGGG + Intergenic
968080950 3:195846785-195846807 AGTTATAGAGATGTCTGCTGAGG + Intergenic
970155754 4:13140344-13140366 AGTTATTAGTATGTGTGTTGAGG - Intergenic
970525837 4:16931226-16931248 AGTCATAGAGATGGGTGTGGGGG + Intergenic
970982743 4:22121256-22121278 AGTCATAAAAGTGTGGGTTCCGG - Intergenic
971870513 4:32230906-32230928 AAACATAAATATGAGTGTTGGGG + Intergenic
973834116 4:54792159-54792181 AGTCATAAGGCAGTGTGGTGTGG - Intergenic
976571840 4:86621005-86621027 AGTCATAAATCTGTGTTTTAGGG - Intronic
976936874 4:90646961-90646983 AATGAAAAGGATGTGTGTTGGGG - Intronic
977113162 4:92986371-92986393 AGTGAAAAATATATGTGTTGAGG + Intronic
979161981 4:117472996-117473018 AGCCATAGAGATGTTTGTTTTGG - Intergenic
979429361 4:120610038-120610060 CACCATAAAGATGTGGGTTGTGG + Intergenic
980439675 4:132824861-132824883 AGTCGTAAAAATGTGTGTGTTGG + Intergenic
981185431 4:141796202-141796224 AGTGATAATGATGTGTAATGTGG - Intergenic
983229908 4:165119026-165119048 ATTCATAATGCTGTGTGTTGAGG + Intronic
984153344 4:176162394-176162416 TGTTATAAATATGTGTCTTGTGG - Intronic
984153672 4:176167265-176167287 ATTTATAAAGCTGTGTGCTGGGG - Intronic
987047896 5:14124673-14124695 AGCCATGAAAATGTGTTTTGTGG + Intergenic
987842986 5:23244790-23244812 ATTCATAAAAGTGTGTGTTGGGG - Intergenic
988141554 5:27248802-27248824 AGACATAAATATTTGTGATGTGG + Intergenic
988212383 5:28221969-28221991 ATTGATAAAGGTGTGTGATGTGG + Intergenic
990277118 5:54209176-54209198 GGAGGTAAAGATGTGTGTTGGGG + Intronic
994614802 5:102090989-102091011 GATCAAAGAGATGTGTGTTGGGG - Intergenic
994900173 5:105760840-105760862 AGTGACAAAGATGTGCTTTGGGG - Intergenic
994915606 5:105973757-105973779 AAACATAAAAATGTGTTTTGTGG + Intergenic
999144597 5:149383829-149383851 AGTCAAAGAAATGTGAGTTGGGG + Intronic
1000137232 5:158364651-158364673 TGAGATAAAGATGTGTGTGGAGG - Intergenic
1000173469 5:158727103-158727125 AGTCAGAAGGATGTGCGTTTTGG - Intronic
1000883907 5:166728740-166728762 TGTCATAAATTGGTGTGTTGGGG + Intergenic
1001116386 5:168944259-168944281 AGTCAGATAGCTGTGTCTTGTGG + Intronic
1001782015 5:174376925-174376947 AGAAATAAAGAAGTGTGTTCAGG + Intergenic
1003824640 6:9939780-9939802 AATGATAAATATGTGTATTGAGG + Intronic
1004723513 6:18289690-18289712 AGTCATGACAATGGGTGTTGAGG - Intergenic
1006597837 6:35206531-35206553 AGTCAGAAAGATCTTTGATGAGG + Intergenic
1006702770 6:35989639-35989661 AGTCAAAATGAAGTGTTTTGTGG + Intronic
1008256365 6:49305422-49305444 AGTCTTAAAGCTCTTTGTTGAGG - Intergenic
1010708749 6:79146684-79146706 AGTCATGGAGATGAATGTTGAGG + Intergenic
1010778889 6:79920543-79920565 AGACATAATGATGTGTCTTGGGG + Intronic
1011635366 6:89367358-89367380 GATTATAGAGATGTGTGTTGAGG + Exonic
1013012464 6:106133009-106133031 AGTCATAAACATGTTTCTTGGGG + Intergenic
1013875190 6:114817338-114817360 AATCATGAAAATGTTTGTTGTGG + Intergenic
1015056011 6:128904200-128904222 AGTCAGAAAGCTGTCTTTTGAGG - Intronic
1015186146 6:130418688-130418710 AGTCAGAAAGATCTGGGTTTGGG + Intronic
1015302183 6:131666647-131666669 TGTCATAAAGATGCTCGTTGAGG - Intronic
1016674399 6:146747435-146747457 AGTCATCAAGCTGAGTGGTGAGG + Intronic
1016792861 6:148084348-148084370 AGTTATTAAGATTTGGGTTGGGG + Intergenic
1019355061 7:574104-574126 AATCATGAAAATGTGTGTGGGGG - Intronic
1019405237 7:879963-879985 AGCCATAGAGCTGTGTGATGGGG + Intronic
1019684876 7:2375849-2375871 AGACATTAAGATCTGTTTTGGGG + Intronic
1020583553 7:10035032-10035054 AGACATAAAGAAGTGTGGTGCGG + Intergenic
1021589962 7:22250197-22250219 AGTGATTAAGATTTGTTTTGGGG - Intronic
1021858714 7:24884163-24884185 ATTCATAAAGATGTGAGCTGAGG + Intronic
1023591098 7:41781235-41781257 AGCAATCAAGATGTCTGTTGGGG - Intergenic
1024755623 7:52526816-52526838 AATGCTAATGATGTGTGTTGAGG - Intergenic
1027559563 7:79710624-79710646 AGTCATAAATACGTCTTTTGAGG - Intergenic
1028214492 7:88114881-88114903 AGTCAAAAACATGTATGTTGGGG + Intronic
1029012097 7:97272847-97272869 AGTCCTAAAAATGGGTGCTGAGG + Intergenic
1030434912 7:109505272-109505294 AGTCAAATATATGTATGTTGGGG + Intergenic
1031336991 7:120547490-120547512 ACTCATAGATATGTTTGTTGTGG + Intronic
1033708833 7:143917006-143917028 AGTCATACAGTACTGTGTTGTGG + Intergenic
1034995193 7:155572470-155572492 AGACATGCACATGTGTGTTGGGG - Intergenic
1037237545 8:16739000-16739022 AGGGATAAAGATGTCTCTTGAGG - Intergenic
1038951906 8:32424336-32424358 AGCCATAGTGAAGTGTGTTGAGG - Intronic
1039574866 8:38614993-38615015 AGTGCTAGAGAGGTGTGTTGAGG + Intergenic
1041753730 8:61289751-61289773 AGTCACAAATATGTATCTTGCGG + Intronic
1042305762 8:67330401-67330423 AGTCATAAAAATGGGGATTGAGG + Intronic
1043359074 8:79449605-79449627 AGGCTTTAAGATGTGTGCTGAGG - Intergenic
1043775370 8:84260734-84260756 ATTCAGAAAGATGTGAGTTCTGG + Intronic
1045036378 8:98179523-98179545 AGTCATAAAGCTGACTGTTGGGG + Intergenic
1045744065 8:105396191-105396213 AGACATAGGGGTGTGTGTTGAGG + Intronic
1046460889 8:114534559-114534581 ATTCATAACTATGTGAGTTGAGG - Intergenic
1046695930 8:117339575-117339597 AGTCATAAATATATTTGCTGAGG - Intergenic
1050999758 9:12267381-12267403 ACTCATAAAGCTGTGTTTGGTGG - Intergenic
1052218751 9:25996056-25996078 GGGCATAAGGATGTGGGTTGTGG - Intergenic
1055563724 9:77547544-77547566 AGTGATACAGATGTGTCCTGTGG + Intronic
1056498552 9:87185383-87185405 TGTCTTAAAGATGTGTGTGTGGG + Intergenic
1057092984 9:92276888-92276910 AGTCATAAAGTTGTTTTATGTGG - Intronic
1057917740 9:99070613-99070635 AGTCATAAAATTGTGGGGTGGGG - Exonic
1059621222 9:116007837-116007859 AGTAATAATTATGTGTGTTTAGG - Intergenic
1061279483 9:129589063-129589085 ACGGATAGAGATGTGTGTTGGGG + Intergenic
1061882822 9:133576560-133576582 AGACAGGAAGATGTGGGTTGGGG - Intergenic
1188614415 X:32140200-32140222 AGTTTTCTAGATGTGTGTTGTGG - Intronic
1189320893 X:40086534-40086556 AGTCATAAAGATGTGTGTTGGGG + Intronic
1191770244 X:64748181-64748203 ATTTATATAGATGTGTTTTGTGG + Intergenic
1193528855 X:82628277-82628299 AATTCAAAAGATGTGTGTTGAGG + Intergenic
1193649297 X:84110053-84110075 AGTCACAAAGCTGTGTGTATTGG + Intronic
1194965711 X:100286508-100286530 AGTATTAAAGCTGTGTGATGGGG + Intergenic
1195226367 X:102798629-102798651 AGTCATCCTGATGTTTGTTGAGG - Intergenic
1198002965 X:132458848-132458870 AGTCACATGGATGTTTGTTGGGG - Intronic
1199868074 X:151872233-151872255 AGTCACAAATATCTGTGTTTTGG + Intergenic
1200379291 X:155817723-155817745 ATTCATATAGATGAGTCTTGAGG - Intergenic
1200723710 Y:6638716-6638738 ACTCATTAAGATCTGTGTTATGG + Intergenic
1200974842 Y:9197913-9197935 TGTTATGAAGCTGTGTGTTGGGG + Intergenic
1201576827 Y:15469952-15469974 AGTGATAAAGCTGGGTGTGGTGG + Intergenic