ID: 1189321507

View in Genome Browser
Species Human (GRCh38)
Location X:40090271-40090293
Sequence GAGGGGAGACGGCGGCGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 339}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189321487_1189321507 23 Left 1189321487 X:40090225-40090247 CCGCAGTGCGACCGAGTGTGCAG 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1189321507 X:40090271-40090293 GAGGGGAGACGGCGGCGCCGGGG 0: 1
1: 0
2: 4
3: 39
4: 339
1189321499_1189321507 -3 Left 1189321499 X:40090251-40090273 CCTCGGCGGCGGGAGGGACGGAG 0: 1
1: 0
2: 2
3: 26
4: 261
Right 1189321507 X:40090271-40090293 GAGGGGAGACGGCGGCGCCGGGG 0: 1
1: 0
2: 4
3: 39
4: 339
1189321492_1189321507 12 Left 1189321492 X:40090236-40090258 CCGAGTGTGCAGGGGCCTCGGCG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1189321507 X:40090271-40090293 GAGGGGAGACGGCGGCGCCGGGG 0: 1
1: 0
2: 4
3: 39
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189321507 Original CRISPR GAGGGGAGACGGCGGCGCCG GGG Intronic
900116015 1:1028269-1028291 CAGGGGAGACGGCAGCTCCGAGG - Intronic
900168369 1:1254163-1254185 GAGGGGAGACGGCCGAGACCCGG + Intronic
900237572 1:1600057-1600079 CAGCGGGGACGGCGGCGGCGCGG - Exonic
902287685 1:15417184-15417206 GTGGGGAGACGGCTGTGCGGGGG - Intronic
902998080 1:20243113-20243135 GAGGGGAGGCGGCAGCGGAGAGG - Intergenic
904289862 1:29478223-29478245 GAGGGGAGAGGTCAGCGCTGAGG - Intergenic
904528979 1:31155476-31155498 GGGCGCAGAGGGCGGCGCCGGGG + Intergenic
905414381 1:37794388-37794410 GCGGGGCGGCGGCGGCGGCGGGG - Exonic
905911993 1:41661747-41661769 GAGGGGTGAGCGCCGCGCCGGGG + Intronic
906062769 1:42959011-42959033 GAGGGGAGTGGCCGGGGCCGGGG + Intergenic
906204354 1:43979234-43979256 GGAGGGAGGCGGCGGCGCTGTGG + Intronic
908501200 1:64745184-64745206 GGCGGGAGACGGCGGCGGCGAGG + Exonic
911612239 1:99970036-99970058 GACGGGAGCCGGCGGCGCTGCGG + Intronic
911618371 1:100038657-100038679 GAGGCGAGGCTGCGGCGACGAGG - Intronic
915200138 1:154221098-154221120 GAGGGGATACGGCGGGGGCAGGG - Intronic
915355979 1:155255374-155255396 CACAGGAGACAGCGGCGCCGCGG - Exonic
915441924 1:155950866-155950888 GCGGGGAGGCTGCGCCGCCGAGG + Exonic
916792528 1:168136767-168136789 GCGGGGAGGCGGCTGGGCCGGGG - Intronic
917526541 1:175793256-175793278 GAGAGGAGAAGGCGGTGCTGTGG + Intergenic
917974380 1:180229854-180229876 GGTCGGAGACGGCGGCGCCCTGG - Intergenic
921585494 1:216941582-216941604 GAGGGGAGACGGTGGGGCATTGG + Intronic
922335555 1:224616209-224616231 GGGCGGAGACTGCAGCGCCGGGG - Intronic
923126789 1:231040322-231040344 GAGGAGAGGGGGCGGGGCCGGGG - Intergenic
924408453 1:243777146-243777168 GGGGGGAGACGGGGGCGGTGGGG + Intronic
924415183 1:243850332-243850354 GAGGAGAGAGGGCGGCGGCGGGG + Intronic
1063448303 10:6134202-6134224 CAGGGGAGACGGAGGCCCTGAGG - Intergenic
1064219776 10:13430939-13430961 CAGGGGAGACAGAGGCGCCAAGG - Intergenic
1066370407 10:34814833-34814855 GCGGGGAGGGGGCGGCGGCGGGG - Intronic
1069043318 10:63717568-63717590 GCGGGGGGGGGGCGGCGCCGAGG - Intergenic
1069667223 10:70170666-70170688 GACGGGAGCAGGCGGGGCCGAGG - Intergenic
1069698353 10:70404348-70404370 GCGGGCAGGCGGCGGCGGCGGGG - Intergenic
1071710213 10:88042481-88042503 GAGGTGAGCCGGCAGCGCCCTGG + Intergenic
1072654398 10:97319972-97319994 GGCGGGAGGCGGCGGCGCCCCGG - Exonic
1072710567 10:97713537-97713559 GAGGGGAAAGGGGGGCGCCAGGG + Intronic
1073340919 10:102744007-102744029 GGAGGGAGGTGGCGGCGCCGTGG + Exonic
1074546268 10:114404277-114404299 AGGGGGCGACAGCGGCGCCGCGG - Intronic
1074853251 10:117455491-117455513 GAGGGGAGGCTGAGGCCCCGAGG - Intergenic
1075196793 10:120366741-120366763 GGGGGGAGAAGGCTGCTCCGAGG + Intergenic
1075587156 10:123666311-123666333 GCCGGGCGGCGGCGGCGCCGAGG + Intergenic
1076597897 10:131637318-131637340 GAGGGAGGACAGCGGCGCGGCGG - Intergenic
1076785970 10:132750115-132750137 GAGGGGAGACGCTGGTGCTGTGG + Intronic
1076986018 11:236446-236468 GAGGCGGGACCGGGGCGCCGGGG - Intronic
1077040695 11:520708-520730 GAGGGGAGAGGGCGACTCGGGGG - Intergenic
1077136715 11:1003224-1003246 GAGGGGAGATGGGGGCGCCCAGG + Intronic
1077207950 11:1353073-1353095 GAGGGGAGTCGGCGGGGATGAGG - Intergenic
1077338479 11:2015834-2015856 GAGGGGAGCCGGCGGCCCACGGG - Intergenic
1077386200 11:2270638-2270660 GAAAGGCGACGGCGGCGGCGCGG - Exonic
1080458551 11:32435368-32435390 GCGAGGAGACGGCGGGGCCCGGG + Exonic
1081528396 11:43942463-43942485 GCGGGGGGCGGGCGGCGCCGGGG + Exonic
1082162814 11:48902107-48902129 GAGTGGGGACGGCGGTGGCGGGG + Intergenic
1082238604 11:49850627-49850649 GAGTGGGGACGGCGGTGGCGGGG - Intergenic
1084070135 11:66728374-66728396 GCGGCGGGACTGCGGCGCCGCGG + Intronic
1084561191 11:69906307-69906329 GAGGGGAGGGGGCAGCGTCGAGG + Intergenic
1085011244 11:73142710-73142732 GAGCGGAGACGCGCGCGCCGGGG - Intergenic
1085322537 11:75583694-75583716 GAGGGGAGAGGACGGCCCCGCGG - Intergenic
1086697967 11:89865523-89865545 GAGTGGGGACGGCGGTGGCGGGG + Intergenic
1086708195 11:89978965-89978987 GAGTGGGGACGGCGGTGGCGGGG - Intergenic
1089729597 11:120511936-120511958 GAGGGGACTCGGGGGCGCGGGGG - Intronic
1202821463 11_KI270721v1_random:71016-71038 GAGGGGAGCCGGCGGCCCACGGG - Intergenic
1091383573 12:78106-78128 GCGGGGAGGCGGGGGCGCCCGGG - Intronic
1091823258 12:3491752-3491774 GAGCGGCGGCGGCGGCGCGGTGG - Intronic
1092861475 12:12723873-12723895 TTGGGGAGACGACGGCGCAGTGG - Intergenic
1093958617 12:25250351-25250373 GAGGGGAGGCCGGGGCGCCGCGG + Intronic
1096847868 12:54418069-54418091 CTGGGGAGACGGGGGCTCCGTGG - Intronic
1097154960 12:57006083-57006105 GAGGGGAGACCGCGGCGCCCGGG - Intronic
1098254792 12:68606082-68606104 GAGGGGAGACGGCGGCGGGGGGG + Intergenic
1098595758 12:72272278-72272300 GAGGCGAGAGCGCGGCGCAGGGG + Intronic
1099956110 12:89353719-89353741 GCGGGGAGACGGGGACGGCGGGG - Intergenic
1101661164 12:106766678-106766700 GGGGTGAGAGGGCGGCGGCGGGG - Intronic
1102547935 12:113670150-113670172 GAGAGGAGACGGCGGCAGGGGGG + Intergenic
1103317596 12:120068991-120069013 GAGAGGAGACAGCAGCGCAGGGG - Intronic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1103869044 12:124077888-124077910 AAGGGGAGACGGTGGAGCTGGGG - Intronic
1104869583 12:131985383-131985405 GCCGGGAGACGGCGCTGCCGAGG + Intronic
1104929251 12:132329475-132329497 GAGGGGGGCCGGGGGCGCCGGGG + Intergenic
1104990052 12:132619753-132619775 GAGGGGATCCCGCGGCGCTGGGG + Intronic
1105022817 12:132828695-132828717 GAGGGGCGGCGGCGGGGCCTGGG - Exonic
1105389265 13:19959362-19959384 GAGGGGACCCGGCGGAGCAGAGG - Intronic
1106568512 13:30906694-30906716 CCGGGGAGCCGGCGGCGGCGCGG + Exonic
1112441346 13:99426904-99426926 GAGGGGAGACGGTGGAGGAGAGG + Intergenic
1113578460 13:111411441-111411463 GAGGTGAGCAGGCGGCGTCGCGG + Intergenic
1113914832 13:113863960-113863982 GAGGCGAGCCGCGGGCGCCGCGG + Exonic
1114452638 14:22837136-22837158 AAGGAGAGTCGGCGGCGCAGGGG - Intronic
1118752422 14:68816662-68816684 GAGGGGAGACACAGGGGCCGGGG + Intergenic
1118762866 14:68891112-68891134 GTGGGGAGACGGCAGCCCAGGGG - Intronic
1119392815 14:74302763-74302785 GGGGCGAGACGGGGGCGCCAGGG + Intronic
1119438526 14:74612806-74612828 GAGCGAAGGCGGCGGCGCCAGGG - Intergenic
1119539300 14:75428216-75428238 GGGGGGAGGCGGCGCCCCCGGGG - Intronic
1120809863 14:88792547-88792569 GACGGGAGGCGGCGGCGGCCCGG + Exonic
1120993574 14:90398189-90398211 GGGAGGAGGCGGCGGCGCCGCGG + Intronic
1122009874 14:98737216-98737238 GAGGGAATATGGCGGCACCGTGG - Intergenic
1122103278 14:99430740-99430762 GAGAGGAGAAGGTGGCGCCTGGG - Intronic
1122961106 14:105093920-105093942 GAGAGGCGAGGGCGGAGCCGCGG + Intergenic
1124453867 15:29822545-29822567 GCGGGGAGGGGGCGGGGCCGCGG + Intronic
1124624163 15:31298809-31298831 GAGGGGAACCGGCGGGGCCTAGG - Intergenic
1125516367 15:40323542-40323564 GAGGGGAGGCGGCGGCTGCCGGG - Intergenic
1125536079 15:40441673-40441695 GAGGCGAGCCGGCTCCGCCGCGG - Intronic
1125684982 15:41558851-41558873 GCGGGGCGCCGGCGGGGCCGCGG + Intronic
1126668474 15:51094868-51094890 GAGGGGAGGCGCGAGCGCCGAGG + Intronic
1127144112 15:56007290-56007312 CGGGGGAGGCGGCGGCGGCGGGG + Intergenic
1127144120 15:56007308-56007330 CGGGGGAGGCGGCGGCGGCGGGG + Intergenic
1127144128 15:56007326-56007348 CGGGGGAGGCGGCGGCGGCGGGG + Intergenic
1127144136 15:56007344-56007366 CGGGGGAGGCGGCGGCGGCGGGG + Intergenic
1127144144 15:56007362-56007384 CGGGGGAGGCGGCGGCGGCGGGG + Intergenic
1129677871 15:77642223-77642245 GAGGGGAGACAGCTGCGGAGGGG + Intronic
1129817246 15:78565712-78565734 GCGGGGCGATGGCGGCGCGGGGG + Exonic
1129846617 15:78770713-78770735 GAGGGGAGACTGAGGAGCAGTGG + Intronic
1130255295 15:82323240-82323262 GAGGGGAGACTGAGGAGCAGTGG - Intergenic
1130599679 15:85266766-85266788 GAGGGGAGACTGAGGAGCAGTGG + Intergenic
1130952810 15:88605604-88605626 GAGGGGAATCAGAGGCGCCGGGG + Intergenic
1132337907 15:101060670-101060692 GAGGGGAGACAGCGATGCCGGGG + Intronic
1132548598 16:544889-544911 GAGGGGAGACGACGACGTGGGGG - Intronic
1132900428 16:2251296-2251318 CAGGTGAGCGGGCGGCGCCGAGG - Exonic
1133215628 16:4290591-4290613 GAGGGGAGACGGAGAGGCAGAGG - Intergenic
1136378147 16:29877357-29877379 GAGGAGAGAAGGCGGCGGCGCGG + Exonic
1136485934 16:30571664-30571686 GCGGGGAGGCGGCGGCTCCAGGG - Exonic
1136534978 16:30893973-30893995 GACGGGAGGCGGCCCCGCCGCGG - Exonic
1136928556 16:34397313-34397335 CAGGGGAGACAGAGGCACCGAGG + Intergenic
1136976018 16:35014491-35014513 CAGGGGAGACAGAGGCACCGAGG - Intergenic
1137708232 16:50549337-50549359 GAGGGAAGAAGGAGGCGCGGTGG - Intronic
1137738469 16:50742263-50742285 GAGGCCAGGCGGCTGCGCCGAGG - Intronic
1139403006 16:66696853-66696875 AGGTGGAGGCGGCGGCGCCGCGG + Intergenic
1141961044 16:87409387-87409409 GAGGGGGGACGGCGACAGCGCGG - Exonic
1142014945 16:87740416-87740438 GAGGGGAGGCGGCTGCTCCTGGG - Intronic
1142072626 16:88099583-88099605 GAGGGGGGAGGGCGTCGCCCGGG + Intronic
1142267426 16:89070951-89070973 GAGGGTTGAGGGCGGCGGCGGGG - Intergenic
1142727983 17:1830200-1830222 GAGGGGAGCCCGGGGCGACGGGG + Intronic
1142867538 17:2799841-2799863 AAGGGGAGACAGCGCCGCTGAGG - Intronic
1143092224 17:4455663-4455685 GAGGGGAGAGGGCGGCAGTGGGG - Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143487536 17:7262853-7262875 GCGGGGAAAGGGCGGCGCCGAGG - Intronic
1143830300 17:9645678-9645700 GAGCGGCGGCGGCGGGGCCGGGG - Exonic
1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG + Exonic
1144910016 17:18672885-18672907 GAGCGGAGAAAGCGGGGCCGGGG + Intronic
1145031449 17:19507764-19507786 CAGGGGAGAAGGGGACGCCGGGG - Intronic
1146371092 17:32266006-32266028 GCGAGGAGGCGGCGGCGGCGCGG + Intergenic
1147285721 17:39401506-39401528 GAGGGGTGACGCCGGGACCGTGG + Exonic
1147971536 17:44220985-44221007 CCCGGGAGGCGGCGGCGCCGAGG - Intronic
1148323786 17:46771927-46771949 GAGGCGCGGCGGCGGCGCGGCGG - Intronic
1148796395 17:50199332-50199354 AGGGGGAGAGGGCGGGGCCGGGG + Intronic
1149079386 17:52635437-52635459 GAGGGGAGAGGGAGGGGCCATGG + Intergenic
1150108755 17:62479526-62479548 GAGGAGAGACGGGGGCCCCCAGG + Intronic
1150250090 17:63700230-63700252 GGGGGTCGGCGGCGGCGCCGGGG - Intronic
1150976852 17:70097237-70097259 GTGGGGAGACGGGGGCGCATGGG - Intronic
1151729875 17:75904861-75904883 GAGGGAAGATGGCGGCGCCCTGG - Exonic
1151785817 17:76274387-76274409 GAGGGGAGCTGCCGGGGCCGGGG + Intronic
1152230204 17:79110542-79110564 GAAGGGAGACGGCGCTGTCGAGG - Intronic
1152352888 17:79793192-79793214 GAGTGGGGACGGCCGCGGCGGGG - Exonic
1152468267 17:80477377-80477399 GCGGGCAGGCGGCGTCGCCGGGG + Intronic
1152542135 17:80981751-80981773 GAGGGGCTGCGGCAGCGCCGGGG - Intergenic
1152667622 17:81580429-81580451 GAAGGGAGATGGCTGTGCCGGGG - Intronic
1152817833 17:82418662-82418684 GAGCGGAGGCGGCGGCCGCGAGG + Exonic
1152848106 17:82614955-82614977 GAGGGGAGACGGTGGACCTGGGG + Exonic
1152863002 17:82706608-82706630 GGGTGGTGACGGCTGCGCCGCGG - Intergenic
1152905144 17:82965892-82965914 GAAGGGACACGTCGGCCCCGTGG - Intronic
1152924187 17:83080005-83080027 GAGGGGAGGGGGCCGGGCCGGGG - Intronic
1153238737 18:3012801-3012823 GCGGGGAGCCGGGGGCGTCGGGG - Intronic
1153939854 18:9968441-9968463 GAGGGGACACGGGGGCGCCTGGG - Intergenic
1154441535 18:14393603-14393625 GTGGGGAGCCTGCTGCGCCGCGG - Intergenic
1157386736 18:47264050-47264072 GAGGGCAGAGGGCGGGGGCGAGG + Intergenic
1157813792 18:50716801-50716823 GAGGGGAGACGGTGCCCCTGAGG - Intronic
1158648893 18:59269373-59269395 GAGGGGCGACAGCGTCGCGGAGG + Exonic
1160500998 18:79400956-79400978 GTGGGGAGACGGCGGCGGGGAGG - Intronic
1160538287 18:79606986-79607008 GAAGGAAGACGGCGCCGCGGGGG + Intergenic
1160875890 19:1295999-1296021 GGGGGGAGTGGGCGGGGCCGCGG + Intronic
1160875906 19:1296032-1296054 GGGGGGAGTGGGCGGGGCCGCGG + Intronic
1160910222 19:1470638-1470660 GCTGGGGGAGGGCGGCGCCGCGG + Exonic
1160927656 19:1554611-1554633 GAGGGGAGACCCCGGGGCAGGGG - Intergenic
1161065530 19:2235691-2235713 GAGGGGAAAGTGCGGCGCTGCGG + Intronic
1161521121 19:4723910-4723932 GGGGGGAGCCCGCGGCGCGGCGG + Intronic
1161802667 19:6424620-6424642 CGGGGGAGCCGGAGGCGCCGGGG - Exonic
1162046827 19:8005534-8005556 GGCGGGAGGCGGCGGCGGCGCGG + Exonic
1162099858 19:8333263-8333285 GATGGTCCACGGCGGCGCCGTGG + Intronic
1162523991 19:11197118-11197140 GCGGGGAGAGGGCAGAGCCGGGG + Intronic
1162790231 19:13058959-13058981 AAGGTGAGACGGTGGCTCCGGGG - Intronic
1162910980 19:13847640-13847662 GAGGGGAGGCTGGGGCGGCGGGG + Intergenic
1162929879 19:13952554-13952576 GAGCGGCGGCGGCGGCCCCGGGG + Exonic
1163031211 19:14545405-14545427 GAGAGGAGACAGCGGTGCAGAGG - Intronic
1163663951 19:18594496-18594518 GAGGGGAGACCCCGGCGCGGCGG + Intronic
1164402234 19:27910186-27910208 CAGAGGAGAAGCCGGCGCCGAGG - Intergenic
1165419994 19:35717933-35717955 GAGGGGAGAGAGCGGGGGCGGGG - Intergenic
1166389628 19:42401842-42401864 GCGGGGAGACGGGGGCTGCGGGG - Exonic
1167091737 19:47349081-47349103 GGGAGGAGAGGGCGGGGCCGGGG + Intergenic
1167344701 19:48937918-48937940 CAGGGGAGACGGAAGCTCCGTGG - Intronic
1167441924 19:49513575-49513597 GAGCGGAGAAGGCAGCGCCAGGG - Intronic
1167471378 19:49677931-49677953 GAGGGGAAACGGGGTCGGCGGGG - Intronic
1167995120 19:53395637-53395659 GGAGGGAGGCGGCGGCGCCACGG - Intronic
1168106409 19:54168295-54168317 GTGGGGGGAAGGCGGCGCAGGGG + Intronic
1168297280 19:55383678-55383700 GCGGGGAGACGGAGGGACCGAGG - Intronic
925714234 2:6770253-6770275 GAGGGGAGACGCAGGCTCCTGGG + Intergenic
926901358 2:17754362-17754384 GTGGAGAGACGGCGCCGCCCGGG + Intronic
929094936 2:38254437-38254459 GAGGGGACATGGCGGCGGGGGGG + Intergenic
929872552 2:45771403-45771425 GAGGGGAGGTGGCCGCGCCAGGG - Intronic
932036434 2:68251856-68251878 GTGGGGCGACGGCGGGGCGGCGG + Intronic
932341493 2:70965163-70965185 GAGGGGAGACCCGGGAGCCGAGG - Exonic
932688798 2:73895064-73895086 GAGGGAAGAGGGCGGCACCAGGG + Intronic
934588267 2:95525398-95525420 GAGTGGGGACGGCGGTGGCGGGG - Intergenic
935237562 2:101151330-101151352 GAGAGGCGACGGCGGCGCGCGGG + Intronic
935622830 2:105144103-105144125 GGGAGCAGCCGGCGGCGCCGCGG + Intergenic
937931084 2:127205658-127205680 GAGGGGCGACGCTGGCTCCGTGG - Exonic
938982378 2:136539045-136539067 GAGGGGAGGGGGCGGGGGCGGGG - Intergenic
940517241 2:154697943-154697965 GAGGGCAGGAGGCGGCGCAGCGG - Intergenic
942241200 2:173964956-173964978 GCGGGGAGACGGCGTTGCTGGGG + Intronic
942890473 2:180980971-180980993 GAGGTAAGGCGGCGGGGCCGGGG + Exonic
946617766 2:221528019-221528041 GAGGGGAAACGGCGGGGTTGGGG - Intronic
947602679 2:231464268-231464290 GAGGGGCGAGCGCGGCGCCGCGG - Intronic
948828705 2:240586889-240586911 GATGGGAGCCCGCGGAGCCGAGG + Exonic
948874850 2:240820826-240820848 GAGGCGAGGCGGCGGGTCCGCGG - Intergenic
948945902 2:241218510-241218532 GGGGGGAGCTGGGGGCGCCGTGG + Intronic
948946736 2:241224299-241224321 GAGGAGAGAAGCCGGCGCTGGGG - Exonic
949051933 2:241902325-241902347 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051940 2:241902342-241902364 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051947 2:241902359-241902381 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051954 2:241902376-241902398 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051961 2:241902393-241902415 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051968 2:241902410-241902432 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
1168757429 20:326646-326668 AAGAGGAGACGGTGGCGTCGGGG + Exonic
1171215706 20:23350763-23350785 TGCGGGAGAGGGCGGCGCCGGGG + Exonic
1172094133 20:32452443-32452465 GAGGGGAGAGGGGGGCGCTGGGG + Intronic
1172100578 20:32482605-32482627 GAGGGGACACGGCGGGGCGGGGG - Intronic
1172408145 20:34704389-34704411 CGGGGGAGGCGGCGGGGCCGCGG - Exonic
1172618721 20:36306448-36306470 GAGAGGCGGCGGCGGCGCAGCGG + Exonic
1172618912 20:36307040-36307062 GGGGGGAGCCGGCGGCTCCCGGG - Intronic
1172661793 20:36573668-36573690 GCGGGGAGCGGGGGGCGCCGGGG - Intronic
1172808682 20:37631857-37631879 GATGGGAAATGGTGGCGCCGCGG - Intergenic
1172852599 20:37977335-37977357 GGGGGGAGACGGGGGCGGGGGGG + Intergenic
1173681446 20:44885440-44885462 GAGGAGAGAGGGCGGAGCTGGGG - Intergenic
1176104993 20:63381713-63381735 CAGGGAAGACGGCGGCTCCGGGG + Intergenic
1176184548 20:63771218-63771240 GAGAGGAGCCGGCGGCCCCCGGG + Intronic
1178351155 21:31873703-31873725 TGGGGGAGCCGGCGGCGCCTGGG + Exonic
1178824676 21:36005048-36005070 GGGGGGAGTCGGGGGGGCCGGGG + Intergenic
1179411745 21:41168052-41168074 GAGGGGAGAAGGCGGAGGCCGGG - Exonic
1179422452 21:41247649-41247671 GAGGCGGGGCGGCGGGGCCGTGG + Intronic
1179809994 21:43864708-43864730 CAGGGGAGATGGCGGGGCCCAGG + Intergenic
1179810111 21:43865005-43865027 GAGGGGACACGGGGGCGACACGG - Intergenic
1179891736 21:44338918-44338940 GCGGGGAGAGGGCGGAGCCGGGG - Intronic
1179891746 21:44338940-44338962 GCGGGGAGAGGGCGGAGCCGGGG - Intronic
1179953935 21:44727497-44727519 GAGGGGAGGCTGCGGCGGAGGGG - Intergenic
1179953941 21:44727514-44727536 GAGGGGAGGCTGCGGCGGAGGGG - Intergenic
1180093105 21:45542590-45542612 GTGGGGAGAGGCCGGCGCCGGGG - Intronic
1180876665 22:19178104-19178126 AGGGGGAGGCCGCGGCGCCGCGG - Intronic
1180937397 22:19634701-19634723 GAGGGGAGGCCGCGGCCTCGGGG + Intergenic
1181094429 22:20495846-20495868 GAGAGGAGCCGGCGGGGCGGGGG + Exonic
1181533083 22:23528230-23528252 GAGGGGAGATGGCGGTGGCCTGG + Intergenic
1181902677 22:26169317-26169339 GAGGGGCCGCGGCGGCGCCGGGG - Intergenic
1182294922 22:29307016-29307038 GGGCGGAGACGGCGGCGAGGAGG + Exonic
1182296254 22:29312399-29312421 GAGGGGCGGCGGGGGCCCCGAGG - Exonic
1183160260 22:36108563-36108585 GAGGGGAGGAGGGGGCGCTGTGG + Intergenic
1183358027 22:37369808-37369830 GAGGGGAGATGGAGGCCCGGTGG - Exonic
1183452859 22:37906269-37906291 GAGGGGCGGAGGCGGGGCCGCGG - Intronic
1184352776 22:43955495-43955517 GAGGGCAGAAGGCGGGTCCGCGG - Exonic
1184680919 22:46071728-46071750 GGGCGGGGACGGCGGCGCCGCGG + Intronic
1185055406 22:48576260-48576282 GCGGGGGGAGGGGGGCGCCGCGG - Intronic
1185148317 22:49151021-49151043 GAGGGCAGATGGCGGCGAGGTGG - Intergenic
1185343039 22:50300024-50300046 GGGGGCAGTGGGCGGCGCCGAGG - Intronic
950008002 3:9703920-9703942 TAGGGGCGACGGCAGCGGCGGGG - Exonic
950024264 3:9809938-9809960 GAGAGGAGGCGGCGACGCGGAGG + Intronic
950465245 3:13149519-13149541 GAGGGGAGAGGGTGTCCCCGGGG + Intergenic
952076353 3:29701876-29701898 GATGGGACCGGGCGGCGCCGTGG - Intronic
953427051 3:42804194-42804216 GAGGGGAGACGGAGCCAGCGAGG - Exonic
953768005 3:45758983-45759005 GAGGGGAGACGCAGACCCCGTGG - Exonic
954778999 3:53045747-53045769 GAGGGGCGGCGGCGGCGCCGGGG - Intronic
955161408 3:56468228-56468250 AAGGTGAGACGCCGACGCCGGGG - Exonic
958878098 3:99638416-99638438 GAGGAGAGACGACGGGGCGGGGG - Intergenic
959539836 3:107525151-107525173 GCGCGGGGACGTCGGCGCCGGGG - Intronic
966182244 3:177197687-177197709 GCCGGGAGGCGGCGGCGGCGCGG + Intergenic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
967685278 3:192409907-192409929 CTGGGGAGGCGGCGGCGCGGCGG - Intronic
967858352 3:194134552-194134574 GCGGGGAGAGGGCGGGGGCGAGG + Intergenic
968479022 4:825824-825846 GGGGGGAGAAGCCGGAGCCGGGG + Intronic
968491886 4:894348-894370 CAGGGGTGACGTCGGAGCCGTGG + Intronic
968965544 4:3767480-3767502 GCCGAGAGGCGGCGGCGCCGGGG + Exonic
970332652 4:15002351-15002373 GAGGGGCGACGGGGACGCGGTGG + Intergenic
972396660 4:38664116-38664138 GAGGGGAGAGGGAGCCGCCGCGG - Intergenic
977257574 4:94758019-94758041 GTGCGGAGACCGCGGCGCTGAGG + Intronic
977679634 4:99784920-99784942 GAGAGGAGACGGTGGAGACGGGG - Intergenic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
980129964 4:128809568-128809590 GCGGGGAGCCCGCGGCGCTGGGG - Intergenic
981093345 4:140755867-140755889 GAGGGGAGCCGGGAGCGCTGCGG - Intronic
982357993 4:154490567-154490589 GAGAGGAGGCGGCGGCGCACCGG - Intronic
984462995 4:180059167-180059189 GAGCGGAGCCGCCGCCGCCGCGG - Intergenic
985068384 4:186144813-186144835 GAGGGGAGGCGGCGCCGGCGCGG + Intronic
985212801 4:187613269-187613291 TTGGGGAGACGGCAGCGCCAGGG + Intergenic
985658057 5:1142297-1142319 GAGGGGAGACGGGAGGGGCGAGG - Intergenic
985688644 5:1295059-1295081 GCGAGGAGAGGGCGGGGCCGCGG + Intronic
985781095 5:1872281-1872303 GAGGGGAGACAGGGGCCCCAAGG - Intergenic
987374095 5:17218048-17218070 GAGGGGTGAGGGGGGCGGCGAGG + Intronic
988610011 5:32714315-32714337 GAGGGCAGATCGCGGCCCCGGGG + Intronic
990943868 5:61230141-61230163 GAGGGGAGAGGGTGGCTCCTGGG - Intergenic
991900533 5:71455710-71455732 GAGAGGAGGAGGCGGCGGCGGGG + Exonic
992813106 5:80408494-80408516 CAGGCGGGACGGCGGCGCCAGGG - Intronic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
996373256 5:122775209-122775231 GAGGTGAGACCGCGTCGCTGCGG + Exonic
997614239 5:135235723-135235745 GAGGGCAGAGGGAGGAGCCGGGG + Intronic
997652888 5:135535464-135535486 CAGGAGAGGCGGCGGCGCCGCGG - Exonic
998128286 5:139638411-139638433 CAGGGGAGGAGGCGGCTCCGCGG + Intergenic
998352189 5:141508884-141508906 GAGGGGAGGGGGCGGGGCGGTGG + Intronic
998374569 5:141682235-141682257 GAGGGGAGGCGGGGCCGGCGCGG - Intergenic
998463602 5:142326092-142326114 GGGTGGAGCCGGCTGCGCCGAGG + Intronic
999275263 5:150325742-150325764 GAGGGGAGAGGGCTGCTCCCAGG - Intronic
999767926 5:154755268-154755290 GAGGGGAGGGGACGGCGCAGCGG - Intronic
1002044948 5:176536583-176536605 GAGGCGAGACTGCAGCGCAGGGG + Intronic
1002063891 5:176642835-176642857 GGGGGGAGAGGGCGGGGCCATGG - Intronic
1002176433 5:177403802-177403824 GCTGGGAGACGGAGGAGCCGCGG + Intronic
1002184226 5:177446857-177446879 GGGGGGAGGCGGCGGCGGCCCGG - Exonic
1002277662 5:178114109-178114131 GAGGTCAGACGCCGGCGCCAAGG - Intronic
1002580873 5:180208939-180208961 GAGGGCTGCCGGCGGCGCGGCGG - Intronic
1002610300 5:180413416-180413438 GAGTGGAGACGGGGGCCCCTAGG + Intergenic
1002691351 5:181052921-181052943 GCGGGGCGAGGGCGGCGCTGCGG + Intronic
1002898729 6:1393597-1393619 GCGGGGACACGGCGGGGCTGAGG + Intronic
1005826259 6:29633093-29633115 GAGGGAAGGAGGCGGCGCCGGGG + Exonic
1005859155 6:29888084-29888106 GAGAGGAGCCGCGGGCGCCGTGG + Intergenic
1006043223 6:31271717-31271739 GAGGGGAGCCGCGGGCGCCGTGG - Exonic
1006052810 6:31356806-31356828 GAGAGGAGCCGCGGGCGCCGTGG - Exonic
1006256830 6:32838661-32838683 GCGGGGAGACCGCAGCTCCGGGG + Exonic
1007394650 6:41570539-41570561 GAGGGCAGAGGGCGGGGCTGGGG + Intronic
1007451047 6:41940767-41940789 GAGGGGAGGAGGCCGCGCAGAGG - Intronic
1007631404 6:43275353-43275375 GCGGGGCGACGGGGGCGGCGGGG - Intronic
1007795439 6:44343126-44343148 GAGGGGAGACGGCAGCCCCGTGG - Exonic
1008160349 6:48068722-48068744 GTGGGGAGGCGGCGGCGGTGGGG - Intergenic
1010001939 6:70956891-70956913 GAGGGCGGGCGGCGGCGCTGGGG + Exonic
1010703304 6:79077778-79077800 GGAGGGAGGCGGCGGCGGCGGGG - Intronic
1011277026 6:85642213-85642235 CGGCGGAGACGGCGGCGCTGGGG - Intronic
1013273296 6:108561228-108561250 GAGCGGAGAGAGCGGGGCCGGGG - Exonic
1015773540 6:136792282-136792304 GAGAGGAGGCGGCGGCGCGGCGG - Exonic
1017497719 6:154995827-154995849 GATGGGAGGAGGCGGCGCCCCGG + Intronic
1017662457 6:156687539-156687561 GCGCGGAGCGGGCGGCGCCGCGG + Intergenic
1017954814 6:159169279-159169301 CAGGGGCGACGGGGGCGGCGGGG - Intergenic
1019198588 6:170296443-170296465 GAGGGCGGAGGGCGGCGCCAGGG + Intronic
1019211248 6:170407168-170407190 GAAGGGAGACTGCCGAGCCGTGG - Intergenic
1019414348 7:920477-920499 GTGGGTGGAGGGCGGCGCCGCGG - Intronic
1019421750 7:954132-954154 GAGGGGAGGCGGCGGCAGGGGGG + Intronic
1019718673 7:2555096-2555118 GGGGGGAGAGGGGGGCGGCGGGG + Intronic
1020278335 7:6637575-6637597 GCGGGGAGGCGGCGGGGCCGGGG + Intronic
1022741798 7:33129260-33129282 GAGGGGAGAGGGCGGTCACGCGG + Intronic
1026482403 7:70790221-70790243 GTTGGGAGGCGGCGGCTCCGAGG - Exonic
1029607231 7:101606345-101606367 TGTGGGAGCCGGCGGCGCCGGGG + Intergenic
1032021596 7:128409797-128409819 GACACGAGACGGCGGCGCAGCGG - Exonic
1033656739 7:143380545-143380567 GAGGTGGGAGGGCGGGGCCGAGG - Intergenic
1033757009 7:144403908-144403930 GAGCGGAGCAGGCGGCGCCCAGG - Intronic
1034218902 7:149429507-149429529 GAGTGGAGACGGAGGTGCTGTGG - Intergenic
1034251240 7:149692632-149692654 CAGGGGAGGCTGCGGCGGCGCGG - Intergenic
1034253996 7:149714685-149714707 GAGGGGAGGGGGCGGGGACGAGG + Intergenic
1034418789 7:150978386-150978408 GGGGGGAGAGGGCGGTGCTGCGG - Intergenic
1035630180 8:1101501-1101523 GAAGGCAGACGGGGGTGCCGGGG + Intergenic
1035743728 8:1946821-1946843 GCGGGGACACGGAGGCCCCGAGG - Intronic
1037674272 8:21040969-21040991 GAGGGGAGAGGGCGGGGAAGTGG - Intergenic
1038807982 8:30812457-30812479 GAGGGGGGAGGGCGGCGGCCGGG - Exonic
1039595450 8:38787122-38787144 CGGGGGCGGCGGCGGCGCCGGGG - Intronic
1040951060 8:52939618-52939640 GAGGGGTGGGGGTGGCGCCGCGG - Exonic
1041085120 8:54249687-54249709 GAGGGCAGAGGGCGGGGCAGCGG + Intergenic
1041673649 8:60516956-60516978 GAGGCGGGGCGGAGGCGCCGCGG + Exonic
1045571339 8:103371665-103371687 GCGGGGAGGCGGCGGGGCCCTGG - Exonic
1046547418 8:115669074-115669096 GCGGGGCGGCGGCGGCGGCGCGG - Intronic
1048971767 8:139649085-139649107 GAGGGGAGGCCACGGCGTCGGGG - Intronic
1049361040 8:142212763-142212785 GAGGGGAGAGGGAGGGGCCAGGG - Intronic
1049405533 8:142450384-142450406 GGGAGGAGGCGGCGGCGCCGAGG - Intronic
1049585442 8:143430634-143430656 GCGGGGAGGAGGCGGCGACGCGG - Intergenic
1050183309 9:2943446-2943468 GAGGGGAGGCGGCGGCAGTGAGG - Intergenic
1051609978 9:18951595-18951617 GAGGGGATACGACGGCGAGGTGG - Intronic
1051898107 9:22009344-22009366 GTGGGGAGACGCCGGCCCCTTGG - Exonic
1053240061 9:36487787-36487809 GGGGCGGGAGGGCGGCGCCGAGG + Intergenic
1053417098 9:37953657-37953679 GAGGGGAGACCGAGGCACTGGGG - Intronic
1055030577 9:71768749-71768771 CAGGGGAGGAGGCGGCGGCGCGG + Exonic
1057259662 9:93576655-93576677 GCGGGGCGCAGGCGGCGCCGCGG - Exonic
1057933988 9:99221624-99221646 AGGCGCAGACGGCGGCGCCGCGG + Exonic
1058058771 9:100473986-100474008 GTGGGGAGGCGGTGGGGCCGGGG + Intronic
1059653295 9:116334834-116334856 CAGGGGAGACAGAGGGGCCGAGG - Intronic
1061089928 9:128420806-128420828 GAGGGGAGGGGGCGGGGCCTGGG - Exonic
1061438088 9:130579446-130579468 GGGGCGGGACGGCAGCGCCGGGG - Intronic
1062139128 9:134945733-134945755 GAGGGCAGAGGGTGGCGCGGAGG + Intergenic
1062551186 9:137087318-137087340 GGGTGGAGAGGGCGGCGCCTGGG - Intronic
1062558667 9:137129391-137129413 GGGTGGAGAGGGCGGCGTCGGGG + Intergenic
1062595112 9:137295875-137295897 GAGGGGCGAGGGCAGAGCCGAGG - Intergenic
1185945739 X:4374061-4374083 GAGGCGAGACGGCAGAGCCTTGG - Intergenic
1186466249 X:9786372-9786394 GCGGGGAGGGGGCGGGGCCGGGG - Intergenic
1187225893 X:17375285-17375307 GCGGGGAGAGGCCTGCGCCGGGG + Intergenic
1187419545 X:19122534-19122556 GAGCGGCGGGGGCGGCGCCGAGG - Exonic
1189321507 X:40090271-40090293 GAGGGGAGACGGCGGCGCCGGGG + Intronic
1189821427 X:44873144-44873166 GGGGGGTCACGGCGGCGGCGTGG + Intergenic
1195022299 X:100841779-100841801 GAGAGGAGGAGGCGGCGGCGCGG - Intergenic
1196819567 X:119692457-119692479 GGCGGGCGGCGGCGGCGCCGGGG - Intronic
1199445044 X:147911812-147911834 GAAGAGAGAGGGCGGGGCCGAGG + Intergenic