ID: 1189322320

View in Genome Browser
Species Human (GRCh38)
Location X:40094479-40094501
Sequence CCGGGCTGGTGGGAGCGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 435}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189322320_1189322334 10 Left 1189322320 X:40094479-40094501 CCCCCGCGCTCCCACCAGCCCGG 0: 1
1: 0
2: 2
3: 35
4: 435
Right 1189322334 X:40094512-40094534 ACAGTCACAGCTCCGCGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 58
1189322320_1189322335 11 Left 1189322320 X:40094479-40094501 CCCCCGCGCTCCCACCAGCCCGG 0: 1
1: 0
2: 2
3: 35
4: 435
Right 1189322335 X:40094513-40094535 CAGTCACAGCTCCGCGCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189322320 Original CRISPR CCGGGCTGGTGGGAGCGCGG GGG (reversed) Intronic
900180293 1:1308210-1308232 CCGGGATGGTTGGAGCGGGCGGG - Intronic
900360605 1:2287125-2287147 CCGGGCGGGAGGGTGCGCAGGGG - Intronic
900371839 1:2335694-2335716 GCAGGCGGGTGGGAGCGGGGCGG + Intronic
900652331 1:3735847-3735869 CAGGCCTGGTGGGAACGCTGGGG - Exonic
901120688 1:6890608-6890630 CCAGGCTGGAGGGAGTGCAGTGG + Intronic
901500867 1:9651992-9652014 CCGGGCTGCTGGGACCTGGGCGG + Intronic
901860402 1:12070663-12070685 TGGGTCTGGTGGGAGCGCAGAGG + Intronic
901925470 1:12563466-12563488 CTGGGCTTGTGGGTGCGCAGAGG + Intergenic
903039815 1:20520954-20520976 CCAGGCTGGAGGGAGTGCGGTGG - Intergenic
904211634 1:28889706-28889728 CTGGGGTGGTGGGAGTGAGGAGG + Intronic
904830660 1:33304532-33304554 CCGGGCTGGATGGAGTGCAGTGG + Intergenic
905085110 1:35367301-35367323 CCAGGGTGGTGGGAGGGCAGAGG - Intronic
905449009 1:38045442-38045464 CGGGGGCGGTGGGGGCGCGGAGG + Exonic
905516944 1:38568977-38568999 AAGGGCAGGTGGGAGCGCGAGGG + Intergenic
907012564 1:50977682-50977704 CTGGGCTGGGGGCAGCGCGCGGG - Intergenic
907277801 1:53326766-53326788 CCGCGCAGGTGGCAGCGCGGCGG + Intronic
908217444 1:61968701-61968723 GTGGGGTGGTGGGAGCGGGGAGG - Intronic
908611762 1:65868915-65868937 ACGGGGTGGTGGGAGGGAGGTGG - Intronic
908976495 1:69905399-69905421 GTGGGGTGGTGGGAGCGGGGAGG - Intronic
910277408 1:85464481-85464503 TCGGGCAGGTGGGTGGGCGGGGG - Intronic
910404002 1:86866434-86866456 ACGGGCTGGCAGGAGGGCGGGGG + Intronic
912246364 1:107965231-107965253 ACGCGCGGGTGGGAGCGCGCCGG + Intergenic
914673449 1:149889447-149889469 CCGGGTGGGTGGGGGCGGGGTGG - Intronic
919790709 1:201289073-201289095 CTGGGCTGCTGGGAGCACCGTGG - Intronic
920072550 1:203312864-203312886 CCGGGCTGGAGTGAGTGCAGTGG - Intergenic
920176981 1:204108024-204108046 CCTGGCTGGAGGGACCGTGGAGG + Intronic
921029803 1:211327074-211327096 CCGGGCTTGCGGGAGACCGGCGG + Intronic
922757079 1:228102612-228102634 CCGGGGTGGGGGGCGCGTGGAGG - Intronic
923400758 1:233614031-233614053 CGGGGCGGGCGGGCGCGCGGGGG + Exonic
923631150 1:235650098-235650120 CCGGGCTGGGGCGGGGGCGGGGG - Intronic
923684159 1:236142438-236142460 CGGGGCCGGTCGGCGCGCGGGGG + Intergenic
924014238 1:239702648-239702670 CCAGGCTGGAGTGAGCGCAGTGG + Intronic
1062819351 10:522585-522607 CCAGGCTGCTGGGTGCGCAGTGG + Intronic
1064209109 10:13348201-13348223 CCCAGCCGGCGGGAGCGCGGCGG - Exonic
1064230962 10:13528991-13529013 GCGGGCTGCGGGGAGGGCGGCGG + Intergenic
1064762250 10:18633255-18633277 GTGGGGTGGTGGGAGCGGGGAGG + Intronic
1069709404 10:70479111-70479133 TCGGGCTGGGGGGTGCCCGGGGG - Intronic
1070195393 10:74151633-74151655 CTGGGCTGGTGCGACCCCGGAGG + Intronic
1070823853 10:79379726-79379748 GGGGGCTGGTGGGAGAGAGGTGG + Intergenic
1071801417 10:89066316-89066338 CAGGGCTGGAGGGAGCCTGGGGG - Intergenic
1072420970 10:95290605-95290627 CCGGGCTGGTCGGCCCGCCGCGG - Intronic
1072705656 10:97679182-97679204 CCAGGCTGGCTGGAGTGCGGTGG + Intronic
1072716039 10:97753202-97753224 CTGGGCTGGTGGGGGAGTGGGGG + Intronic
1073543276 10:104328982-104329004 CTGGGCTGGGGAGAGCGGGGAGG + Intronic
1076053205 10:127351637-127351659 CCGGGCTGGTGGCAGTCCTGGGG - Intronic
1076103031 10:127797834-127797856 GCGGGATGGTGGGAGGGTGGGGG - Intergenic
1076366610 10:129925241-129925263 CCTGGCTGGTGTGAGGGTGGGGG + Intronic
1076627778 10:131832463-131832485 CCTGTCTGGTTGGAGCCCGGAGG - Intergenic
1076725692 10:132412040-132412062 CCCGGCTGCTGGGAGCCAGGAGG - Intronic
1077016588 11:401258-401280 CGGGGCGGGTGTGAGCGGGGCGG - Intronic
1077016658 11:401442-401464 CGGGGCGGGTGTGAGCGGGGCGG - Intronic
1077016663 11:401457-401479 CGGGGCGGGTGTGAGCGGGGCGG - Intronic
1077016689 11:401519-401541 CGGGGCGGGTGTGAGCGGGGCGG - Intronic
1077107297 11:847809-847831 CCAGGCGGGTGGGAGGGCGAAGG - Intronic
1077360874 11:2139597-2139619 AGGGGCTGGGGGGTGCGCGGGGG + Intronic
1077380746 11:2236125-2236147 CCGTGCTGCTGGGGGCGGGGAGG - Intergenic
1077937931 11:6810070-6810092 CCAGGCTGGAGGGAGTGCAGTGG + Intergenic
1078086208 11:8234335-8234357 CCGGGCTGGAGGGAGAGAGTGGG - Intronic
1080836358 11:35944250-35944272 CCGGGCGTGGGTGAGCGCGGAGG + Intronic
1081814648 11:45931761-45931783 CCTGGCCGATGGGAGGGCGGTGG - Intronic
1082282220 11:50282030-50282052 CCAGGCTGGATGGAGTGCGGTGG + Intergenic
1082867282 11:57911463-57911485 CAGCACTGGTGGGAGTGCGGTGG + Intergenic
1082880644 11:58034123-58034145 CCAGGCTAGAGGGAGTGCGGTGG + Intronic
1083287719 11:61671145-61671167 CTGGCATGGTGGGAGTGCGGAGG + Intergenic
1083389632 11:62338091-62338113 CCGGGAGGGCGGGAGCGCCGTGG + Exonic
1083595348 11:63916276-63916298 CCGGCCTGGGGGGAGCGGAGTGG - Intronic
1083807692 11:65084622-65084644 CTGGGCTGGTGAGAGCGTAGTGG + Intronic
1083811220 11:65108043-65108065 CGGGGCTGGCGGGAGCGCTGGGG - Intronic
1083825755 11:65202889-65202911 CAGGGCTGCTGGGAGGGCTGGGG - Intronic
1084070076 11:66728179-66728201 CCGGGCGGGCGGGGGCGCGGCGG + Intronic
1084166116 11:67375471-67375493 CCTGGCTGGTGGGGGCAGGGAGG - Intronic
1085391878 11:76186275-76186297 CTGGTGTGGGGGGAGCGCGGGGG + Intergenic
1085584750 11:77691647-77691669 CTGGGCTGGTGTGAGTGCTGTGG + Intronic
1086912422 11:92488457-92488479 CAGGGCTGGTTGGGGGGCGGGGG - Intronic
1089356150 11:117855330-117855352 TCGGGGTGGCGGGAGCGGGGAGG + Intronic
1089359527 11:117876658-117876680 CGGGGCTGGGGGCAGGGCGGTGG + Exonic
1089495732 11:118907915-118907937 CCCGGCTGGTGGGAGCCCTTTGG - Intronic
1089853429 11:121519449-121519471 CCAGGCTGGTTGGAGTGCAGTGG + Intronic
1091108555 11:132944187-132944209 GCGGGGTGGGGGGAGCGGGGAGG + Intronic
1091238458 11:134037001-134037023 CGGGGCTGGGGGGCGCGGGGAGG - Intergenic
1091672879 12:2465788-2465810 CCGGGCTGGTGGCAGAGCTGAGG + Intronic
1091793663 12:3285427-3285449 GGGGGCTGGTGGGAGCACTGTGG - Exonic
1091804145 12:3343907-3343929 CCGTCCTGATGGGAGCGCAGAGG + Intergenic
1091879388 12:3964570-3964592 CCGGGCTTGTGGGACCGCTTGGG + Intergenic
1091923124 12:4321394-4321416 CCGGGCTGGAGCGAGCAGGGAGG - Intronic
1092054863 12:5500432-5500454 ATGGGCTGGAGGGAGCGAGGAGG + Intronic
1092383599 12:8018749-8018771 CGGGGCCGGCGGGAGCGCAGCGG - Intergenic
1092833069 12:12463985-12464007 CGGGGCTCGTGGGAGCCAGGTGG - Intronic
1093874415 12:24331806-24331828 CCAGGCTGGTTGGAGTGCAGTGG - Intergenic
1095116822 12:38363993-38364015 GCGGGGTGGGGGGAGCGGGGAGG + Intergenic
1095734237 12:45538685-45538707 ACGGGGTGGGGGGAGCGGGGAGG + Intergenic
1096284117 12:50283439-50283461 CAGGGCTGGTAGCAGCGCAGAGG - Exonic
1096322061 12:50623331-50623353 CCAGGCTGGAGGGAGTGCAGTGG - Intronic
1096413196 12:51391666-51391688 CCGGGAGGGTGGGACCGGGGCGG + Intronic
1096647640 12:53047338-53047360 CCGGCCGGGCGGGGGCGCGGCGG - Intronic
1097222663 12:57460133-57460155 CTGGGCTGGGGGGTGTGCGGTGG - Exonic
1097243340 12:57591297-57591319 CGTGGCTGGTGGGACCGAGGAGG - Exonic
1097543661 12:60972209-60972231 ATGGGCTGGGGGGAGCGGGGAGG - Intergenic
1099808374 12:87548331-87548353 GTGGGCTGGGGGGAGCGGGGAGG + Intergenic
1101000015 12:100347977-100347999 CCAGGCTGGAGGGAGTGCAGTGG - Intergenic
1101503572 12:105326615-105326637 CCAGGCAGGTTGGAGTGCGGTGG - Intronic
1101823640 12:108203372-108203394 CTGGGCTGGTGGTAGCTCTGGGG + Intronic
1102473688 12:113175021-113175043 CCGGGCTGGTGCGTGAGCTGGGG - Exonic
1103509964 12:121467372-121467394 CCGCGCTGGAGGGGGCGGGGAGG + Intronic
1103974480 12:124693508-124693530 CCGGCCTGCTGGGAGAGCTGGGG - Intergenic
1103976778 12:124707777-124707799 CCAGGGTGGTGGGAACGTGGTGG + Intergenic
1104970624 12:132529106-132529128 CTGGGCTCGTGGGAGGGTGGGGG + Intronic
1105803217 13:23929401-23929423 CCAGGCTGGTTGGAGTGCAGTGG + Intergenic
1105927119 13:25018409-25018431 CCGCGCTGATGGGCGCGAGGCGG + Intergenic
1106498794 13:30307496-30307518 CAGCGCGGGAGGGAGCGCGGGGG + Intergenic
1107077936 13:36343987-36344009 CCAGGCTGGTTGGAGTGCAGTGG - Intronic
1108408207 13:50125032-50125054 CCGGGCGGTAGGGAGAGCGGAGG - Intronic
1109908940 13:68885310-68885332 GTGGGGTGGGGGGAGCGCGGTGG - Intergenic
1111371227 13:87320282-87320304 GCGGGGTGGGGGGAGCGGGGAGG + Intergenic
1112576455 13:100640765-100640787 CCTGGCTGGAGGGAGGGCAGTGG - Intronic
1113668886 13:112161807-112161829 CTGGGCTGCGGGGAGCGCTGGGG - Intergenic
1114956554 14:27827542-27827564 CCAGGCTGGAGGGAGTGCAGTGG + Intergenic
1115333626 14:32223595-32223617 CCAGGCTGGTTGGAGTGCAGTGG + Intergenic
1118403587 14:65401851-65401873 CCAGGCTGGAGGGAGTGCAGTGG - Intergenic
1119651303 14:76385648-76385670 ACGGGATGGTGGGAGAGCAGTGG - Intronic
1120820833 14:88910473-88910495 CAGGGCTGGTGGGAAAGCCGTGG - Intergenic
1121234138 14:92380001-92380023 CTGTGCTGGTGGGAGGGAGGGGG - Intronic
1121324480 14:93012045-93012067 CTGGGCTGCTTGGAGCGGGGAGG - Intronic
1121876652 14:97459000-97459022 CAGGCCTGGTGGCAGCGTGGAGG + Intergenic
1122601279 14:102923124-102923146 CCGGCCTGGTGTGAAGGCGGAGG - Intronic
1122652526 14:103233222-103233244 CCGGGCTGCTGGGGGCGCTGGGG - Intergenic
1123072066 14:105646803-105646825 ACGGGCTGGTGGGAGGCAGGAGG - Intergenic
1123092067 14:105746330-105746352 ACGGGCTGGTGGGAGGCGGGAGG - Intergenic
1123196725 14:106624121-106624143 CTGGGCTGGAGGGGGCGCGCAGG - Intergenic
1123412924 15:20074088-20074110 CCGGGGTGGCGGGAGGGCCGGGG + Intergenic
1123522266 15:21081201-21081223 CCGGGGTGGCGGGAGGGCCGGGG + Intergenic
1123702769 15:22928069-22928091 CCGGGATGGGGGGAGCTGGGTGG - Intronic
1125512734 15:40301705-40301727 CCTGGGTGGTGGGGGCGCTGGGG - Intronic
1125957236 15:43798978-43799000 GCGGGCTGGTGGGGGAGTGGAGG + Exonic
1126668427 15:51094713-51094735 GCGGGCTGGGCGGTGCGCGGCGG + Intronic
1126800867 15:52295574-52295596 CTGGGCTCCTGGGAGCGCTGTGG - Intronic
1126932751 15:53673079-53673101 CCAGGCTGGCTGGAGTGCGGTGG - Intronic
1128139254 15:65287002-65287024 CTGGGCCGGGCGGAGCGCGGCGG - Intronic
1128547665 15:68578949-68578971 CCGGGCTGGGGGGCGGGGGGAGG - Exonic
1129539323 15:76338094-76338116 CCGGGCCCGGGGGAGCGCTGCGG - Intronic
1130224416 15:82046319-82046341 GCGGGCTGCGGCGAGCGCGGGGG - Intergenic
1130411731 15:83653854-83653876 CCGGGCCGCTCGGAGCGCGCGGG - Intergenic
1130994340 15:88895578-88895600 CTGGTCTGGCGGGAGCGCGGGGG - Exonic
1131097484 15:89665747-89665769 CCGGGCCGGGGGGCGCGCCGGGG + Exonic
1131166512 15:90145648-90145670 CAGAGCTGGTGGGAGAGGGGAGG + Intergenic
1131753228 15:95532426-95532448 CCAGCCTGGTGGGAGGGCTGGGG - Intergenic
1132519923 16:382168-382190 GCGGGATGGAGGGATCGCGGGGG + Intronic
1132568798 16:635167-635189 CCGTGCTGGTGGCTGGGCGGGGG + Intronic
1132583372 16:695197-695219 CCCGGTGGGTGGGAGCGAGGAGG - Intronic
1132754160 16:1474656-1474678 CCGGGCTGGCGGGGGCGCCTGGG - Intronic
1132931738 16:2462249-2462271 CTGGGCTTGTGGGAGCCCTGGGG + Intronic
1132974816 16:2705975-2705997 CAGGGCTGGTGGGGGCTTGGGGG + Intronic
1133076645 16:3285255-3285277 CTGGGCAGGTGGGAGGGAGGAGG + Intronic
1133251234 16:4482988-4483010 CCAGGCTGGATGGAGTGCGGTGG - Intronic
1133505709 16:6410349-6410371 CCAGGCTGGAGGGAGGGCAGTGG + Intronic
1134070148 16:11255723-11255745 CCCGGCGGGTGGGGGCTCGGTGG + Intronic
1136996096 16:35188886-35188908 CCGGGCTGGGGGCAGGGTGGAGG + Intergenic
1137402325 16:48163617-48163639 CCAGGGGGGCGGGAGCGCGGAGG + Intergenic
1137531895 16:49283141-49283163 CCAGGCTGGTAGTAGGGCGGCGG + Intergenic
1137665339 16:50246211-50246233 CGGGGCGCGGGGGAGCGCGGCGG + Intronic
1137788024 16:51152714-51152736 GCGGGGTGGGGGGAGGGCGGTGG + Intergenic
1138349071 16:56336879-56336901 CCGGGCAGGGGGCAGCGCTGAGG + Intronic
1139508970 16:67415714-67415736 CCAGGCTGGATGGAGCGCAGTGG - Intronic
1140476769 16:75242856-75242878 CCGGGGTGGCGGGAGGGCCGGGG + Exonic
1140509121 16:75494860-75494882 CCGGGCTGGTGGCACAGCTGGGG - Intronic
1140686122 16:77435148-77435170 CCGGGCTGGTGCAAGGGCGTGGG + Intergenic
1141596456 16:85099987-85100009 CAGGGGTGGTGGGAGCATGGAGG - Intronic
1141700712 16:85640844-85640866 CCGCGCAGGTGTGAGCGCCGCGG + Intronic
1141831094 16:86510353-86510375 GAGGGCGGGCGGGAGCGCGGGGG + Intergenic
1142129159 16:88424938-88424960 CCGGGCGGGTGGGGGCGGAGGGG - Intergenic
1142150453 16:88510308-88510330 CCTGGCTGAGGGGAGCCCGGTGG - Intronic
1142290489 16:89191909-89191931 TGGGGATGGGGGGAGCGCGGCGG - Intronic
1142631365 17:1228740-1228762 CCGGGGTGGGGGGCGCGCGGCGG + Intronic
1142672071 17:1491879-1491901 CCGCGCTGCTGGGGGCGTGGGGG + Intronic
1142980648 17:3669134-3669156 CCGGGCTGGTGCGATGGCCGCGG + Exonic
1143554332 17:7651321-7651343 GCGGGGTGCTGGCAGCGCGGCGG - Exonic
1143698288 17:8637183-8637205 CCGGGATGGTGGGAGCAGGGTGG + Intergenic
1144021261 17:11241393-11241415 CCGGGCGGGAGGGCGCGGGGAGG - Exonic
1144756484 17:17682840-17682862 CCGGGCTGGCGGGGGCGCGGCGG + Intronic
1144764238 17:17724234-17724256 CCGGGCAGGTCTGCGCGCGGCGG - Intronic
1145863936 17:28228185-28228207 CAAGGCTGGGGCGAGCGCGGGGG + Intergenic
1146492489 17:33292599-33292621 CCGGGCTGGTGGGGTCCCTGGGG - Exonic
1147450210 17:40499695-40499717 CCGGGAGGGCGGGAGCGCAGAGG - Intronic
1147615625 17:41825643-41825665 CCGGGCAGGTGGAGGAGCGGCGG - Exonic
1148489168 17:48012301-48012323 CAGGGCTGCTGGGAGCCAGGGGG - Intergenic
1148675040 17:49440142-49440164 CCGTCCTGGGGGGAGCACGGGGG - Intronic
1149770575 17:59317703-59317725 CCAGGCTGGTGGGAGTGTAGTGG + Intergenic
1150676012 17:67245995-67246017 CCGGGCGGGGCGGGGCGCGGAGG + Intergenic
1150747324 17:67825992-67826014 CCGGGCCGGGGGGGGCGAGGAGG + Exonic
1151119616 17:71778123-71778145 CAGGGCTGGTGAGCGGGCGGTGG + Intergenic
1151495136 17:74454235-74454257 CGGGGATGGGCGGAGCGCGGCGG - Intergenic
1151728276 17:75896807-75896829 CGGGACTGGTGGGACCGCTGCGG - Exonic
1151755371 17:76072569-76072591 CCGGGCTGATGGGATAGCGGCGG + Exonic
1151974164 17:77475149-77475171 CCGGGCTGGGGTGAGCGTGATGG + Intronic
1152070666 17:78132240-78132262 TCGGGCGGGTGGGAGCCTGGCGG + Intronic
1152911201 17:83005845-83005867 CCGGGCAGGGCGGAGGGCGGGGG - Intronic
1153382491 18:4454964-4454986 CGGGGCTGGGGCGTGCGCGGCGG - Intronic
1153911202 18:9708103-9708125 CGGGGCTGGTCCGAGGGCGGAGG + Intergenic
1156466960 18:37353734-37353756 GTGGGCTGGTGGGGGCGGGGGGG + Intronic
1157384098 18:47247611-47247633 CGGTGCTGCTGGGAGCGCCGAGG - Intronic
1158365026 18:56724795-56724817 GTGGGGTGGTGGGAGAGCGGGGG - Intronic
1158740297 18:60134310-60134332 ATGGGGTGGTGGGAGCGGGGAGG + Intergenic
1159722162 18:71905513-71905535 GCGGGGTGGGGGGAGCGGGGAGG - Intergenic
1160233601 18:77067939-77067961 CCTGGCTGGTGTGAGCTCAGAGG - Intronic
1160452887 18:78978047-78978069 CCGGGCTTTGGGGCGCGCGGGGG - Intergenic
1160548873 18:79680326-79680348 CCGGGCTGCTGCGTCCGCGGTGG + Intronic
1160703253 19:518099-518121 CCGGGCTGGGGGGTGCTGGGAGG + Intronic
1160742668 19:694732-694754 CCAGGCTGGTGGGGGAGCTGGGG - Intronic
1160830918 19:1104546-1104568 CCGAGCGGTTGGGGGCGCGGAGG + Intronic
1160872988 19:1285608-1285630 CCGGGCCGGGTGGAGCGCGTGGG + Intergenic
1161101517 19:2424206-2424228 CCGTGCTGGTGGCAGAGAGGTGG + Exonic
1161115552 19:2494851-2494873 CCGGGCTGGCGGTAGCGGGGCGG - Intergenic
1161165668 19:2785789-2785811 CCGGGCTGGAGGGGCAGCGGGGG + Intronic
1161447548 19:4327022-4327044 GCGGCCTGGAGGAAGCGCGGCGG + Intronic
1161499633 19:4606885-4606907 TCGGGGTGGTGGGGGGGCGGGGG - Intergenic
1162895575 19:13763144-13763166 CAGGGCTGGTGGGCGAGCCGGGG - Exonic
1162909607 19:13842134-13842156 AGGGGCTGGTGGGAGCTGGGGGG - Intergenic
1163273609 19:16268894-16268916 ACGGGCTGGTGGGTGGGCGGAGG - Intergenic
1163729447 19:18940897-18940919 CAGGGCTGGAGGGAGCGCGGGGG - Intronic
1164627238 19:29737720-29737742 TCAGGCTGGTGGGAGGGCTGAGG - Intergenic
1166069663 19:40379639-40379661 CCATGCTGGTGGGAGCGGCGGGG + Exonic
1166090299 19:40504029-40504051 CTGGGCTTGTGGGTGCCCGGCGG + Exonic
1166765605 19:45251168-45251190 CCGGGCTGGTCGGGGCGCCGGGG - Intronic
1167559135 19:50215003-50215025 CCAGGCTGAGGGGAGCGGGGGGG + Intronic
1167596612 19:50431720-50431742 CGGGGCTCGCGGGAGCGCAGTGG + Intergenic
1168097122 19:54122238-54122260 CCTTGCTGGTGGGAATGCGGAGG - Intronic
1168110499 19:54189257-54189279 GCGGGCTGGCGGGTGCGGGGCGG - Intronic
1168636287 19:57999814-57999836 CTGGGCTGCTGGGAGCCCAGTGG + Exonic
925038330 2:709347-709369 CCGGGCTGGGGGGTGGGCAGGGG - Intergenic
925203518 2:1988103-1988125 CTGGGCTGGCGGGAGGGTGGAGG - Intronic
925390980 2:3493804-3493826 CTGGGCTGGAAGGAGAGCGGGGG + Intergenic
925912213 2:8581365-8581387 CCAGGCTGGTGAGACAGCGGCGG + Intergenic
925959672 2:9003468-9003490 CCGGTCGGGTGGCACCGCGGCGG + Intronic
926095733 2:10079936-10079958 CCGGGCTGGGCGGCGCGGGGCGG + Exonic
926909279 2:17835266-17835288 CCAGGCTGGATGGAGTGCGGTGG - Intergenic
927181093 2:20447278-20447300 CGGGGGCGGTGGGGGCGCGGGGG - Exonic
929936984 2:46299964-46299986 CCGGGCTGGTGGCCACGCGAGGG + Intronic
930031521 2:47060984-47061006 AGGAGGTGGTGGGAGCGCGGGGG - Intronic
931762709 2:65431726-65431748 GCGGGCTGGTGGCAGCTCCGGGG - Intronic
932180718 2:69643754-69643776 CCGGGCGGGAGCGCGCGCGGGGG - Intronic
932390464 2:71385492-71385514 CAGGGTTGGTGGGAGGGAGGTGG + Intronic
934113779 2:88765474-88765496 CCGCGCTGATGGGCGCGAGGCGG - Intergenic
934237605 2:90245577-90245599 GCGGGCTGGTGGCACCGCGAGGG + Intergenic
934636246 2:95992198-95992220 CCGCGCTGATGGGTGCGAGGCGG + Intergenic
934797402 2:97113228-97113250 CCGCGCTGATGGGTGCGAGGCGG - Intergenic
934836008 2:97590211-97590233 CCGCGCTGATGGGTGCGAGGCGG + Intergenic
936467340 2:112764916-112764938 CCGGGCTGGTGGTTGGGGGGCGG + Intergenic
936938376 2:117859342-117859364 CCGGGCAGGTGCGGGCGTGGAGG - Intergenic
937042765 2:118834653-118834675 CCGGGCAGGCGGGGGCGAGGAGG - Intergenic
937096296 2:119237455-119237477 CCTGGCTGGGGGGAGGGCAGAGG - Intronic
937360999 2:121230126-121230148 CTGTGCTGGTGGGAGCGGGATGG - Intronic
940906705 2:159175934-159175956 CTGGGCTGGGGGCAGCGAGGGGG + Intronic
941808608 2:169734118-169734140 CCGGCCTGCTGGGAGCGAGCGGG + Intronic
942314226 2:174683011-174683033 CGGGGCAGGCGGGCGCGCGGAGG - Intergenic
943932863 2:193877457-193877479 GCGGGGTGGGGGGAGCGGGGAGG - Intergenic
944173076 2:196800438-196800460 GCGGGGCGGTGGGAGCGGGGAGG - Intergenic
945203792 2:207310567-207310589 CCGGGCTGGTGGGGGCAGGATGG + Intergenic
946175793 2:217921359-217921381 CCGGGCTGGTGGGTGGGGAGGGG - Intronic
946185932 2:217980327-217980349 CCGGGCTGGTGGTGGTGCTGAGG - Intronic
948045447 2:234940240-234940262 GAGGGCTGGTGGGAGGGCGGTGG + Intergenic
1168965298 20:1894876-1894898 TCGGGCTGCCGGGAGGGCGGGGG + Intronic
1169904314 20:10585624-10585646 CCAGGCTGGATGGAGCGCAGTGG + Intronic
1170671410 20:18437537-18437559 CCAGGCTGGAGTGAGCGCAGTGG - Intronic
1171439434 20:25148502-25148524 CCGGGGTGGTGGGCGCCCCGGGG - Intergenic
1171824053 20:29878596-29878618 GCGGGCTGGGGGCAGAGCGGCGG - Intergenic
1171866011 20:30488080-30488102 TCGGGGTGGTGGGAGGGGGGTGG + Intergenic
1172391393 20:34567753-34567775 CCGTGCTGCTGGGAGCTCAGTGG - Intronic
1172465044 20:35149933-35149955 CTGGGTTGGGGGGGGCGCGGGGG - Intergenic
1175237546 20:57525123-57525145 CCGGGCTGGCGCGAGAGTGGAGG + Intronic
1175257018 20:57653653-57653675 CATGGCTGGTGGGAGTGTGGAGG - Intronic
1175439631 20:58981529-58981551 CCGGGCGGGCGGGGGCGGGGCGG - Intronic
1175507236 20:59494638-59494660 CCAGGCTGGTGGGTGAGCAGGGG - Intergenic
1175872528 20:62215213-62215235 CAGGGCTGGTGTGAGCCCAGAGG + Exonic
1176088763 20:63309780-63309802 CCAGGCTGGTGGGGGCAGGGAGG - Exonic
1176103733 20:63376057-63376079 CAGGGCTGGTGGGGGTGTGGGGG - Intronic
1176206979 20:63894586-63894608 CCGGGAGGGTGGGAGGGCGCTGG + Intergenic
1176234281 20:64047115-64047137 CCCGGGTGGGGGGAGCGCTGTGG + Intronic
1178104070 21:29299080-29299102 CTGGGCTGGGCGGGGCGCGGGGG + Intronic
1179375438 21:40846708-40846730 CCGGGCCGGGCGGAGCGCGGGGG - Exonic
1179625934 21:42649792-42649814 CTCGGCTCTTGGGAGCGCGGGGG + Intergenic
1179880239 21:44290562-44290584 CCGGGCTGGTGGGCGTCTGGGGG + Intronic
1180038898 21:45265764-45265786 GCCGGCTGGTGGGTGCTCGGGGG - Intronic
1180151560 21:45950798-45950820 CAGGGCTGGAGGGAGGGAGGCGG - Intergenic
1180837060 22:18935176-18935198 CCGTGGTGGCGGGAGTGCGGAGG - Intronic
1181061583 22:20284470-20284492 TGGGGCTGGTGAGAGCCCGGTGG + Intergenic
1181064897 22:20300847-20300869 CCGTGGTGGCGGGAGTGCGGAGG + Intergenic
1181494489 22:23280309-23280331 TCAGGCTGGTGGGAGTGAGGAGG - Intronic
1181634246 22:24167060-24167082 CTGGGCTGGGGTGAGCGGGGTGG - Exonic
1181902866 22:26169925-26169947 CCGGGCTGATGGGAGTGTGGAGG + Intronic
1181947443 22:26529164-26529186 CCAGGCTGGATGGAGTGCGGTGG + Intronic
1183080650 22:35453957-35453979 GCGGGCTGGTGGCAGCCAGGTGG - Intergenic
1183269459 22:36851525-36851547 CCGGGCTGGAGGGAGGGTGCGGG + Intergenic
1183382857 22:37499072-37499094 CTGGGGTGGCGGGAGCGGGGTGG - Intronic
1183607116 22:38872278-38872300 CCCGGCGGGCGGGAGCGCGGCGG + Exonic
1183658409 22:39204370-39204392 CGGGGATGGTGGGAGGGCGCTGG - Intergenic
1183991003 22:41597042-41597064 CTGGGCTGGTGGGAGTGCGTTGG + Intergenic
1184086906 22:42270710-42270732 GCGGGCGGGAGGGCGCGCGGCGG + Intronic
1184720446 22:46309505-46309527 CGGGGCGGGTGGGAGCCCCGGGG + Intronic
1184801445 22:46762841-46762863 CCGGGCAGGTGGGTGTGCCGCGG + Exonic
1184871416 22:47241172-47241194 GCGGGGTGGAGGGAGCGGGGAGG - Intergenic
1185040424 22:48501162-48501184 CCAGTCTTGTGGCAGCGCGGAGG - Intronic
1185055207 22:48575696-48575718 GCGGGCTGCTGGGAGCGCAGAGG + Intronic
1185151102 22:49164401-49164423 CCGGGCCGCTGGGAGCCCTGGGG + Intergenic
1203287153 22_KI270734v1_random:160475-160497 CCGTGGTGGCGGGAGTGCGGAGG - Intergenic
949522300 3:4868459-4868481 CGGGGCTGGGTGGAGGGCGGAGG - Intronic
950381968 3:12623752-12623774 CCAGGCTGGTTGGAGTGCAGTGG - Intronic
950447424 3:13046422-13046444 CTGGGCTGCAGGGAGCGAGGGGG - Intronic
950946479 3:16954168-16954190 GTGGGCTGGGGGGAGCGGGGAGG - Intronic
951485295 3:23203269-23203291 CCGGGCGGGCGCGAGCGCGGCGG + Intronic
952241081 3:31532392-31532414 CCGGGATGGTGGGGGGGAGGGGG + Intergenic
953947645 3:47163590-47163612 CCGGGCCGGTGGGGGAGGGGCGG - Intronic
954186480 3:48920645-48920667 CCAGGCTGGTTGGAGGGCAGTGG + Intronic
954275985 3:49541976-49541998 TCGGGCTGGGCCGAGCGCGGTGG - Intergenic
958581049 3:96023882-96023904 CCAGGCTGGAGTGAGCGCAGTGG + Intergenic
958799408 3:98738082-98738104 CGGGGGTGGGGGGAGGGCGGGGG - Intronic
960257548 3:115527197-115527219 CCGGGGTGGGGGGAGAGGGGAGG - Intergenic
961236884 3:125375056-125375078 CCGGGCCCGGGGGAGGGCGGGGG - Intronic
961616148 3:128182787-128182809 CAGGGCTGGTGGGAGCCCTCTGG - Intronic
962588141 3:136862493-136862515 CCGAGCCGGAGGGGGCGCGGAGG + Intronic
962776149 3:138662253-138662275 GCGGGGTGGGGGGAGCGGGGAGG - Intronic
963733310 3:148992219-148992241 CCCGTCTGGTGGGAGGGCGCCGG + Intronic
965126237 3:164633587-164633609 GTGGGGTGGTGGGAGCGGGGAGG + Intergenic
966182223 3:177197634-177197656 GCGGGCGGGCGGGCGCGCGGGGG + Intergenic
966868517 3:184275951-184275973 CCGGGGTGGGGGGAGGGTGGGGG - Intronic
967849338 3:194070692-194070714 CCGTGCAGGCGGGAGCGCGTGGG + Intergenic
967858212 3:194134145-194134167 CCGGGCAGGCGGGAGGGAGGCGG + Intergenic
968073265 3:195801442-195801464 CCGGGCAGGAGGGAGCCCCGGGG - Intronic
968230855 3:197003713-197003735 CCGGGAGGGCGGGAGCCCGGCGG - Intronic
968491853 4:894242-894264 CCGGGCCGCGGGGAGCGCAGGGG + Intronic
968701381 4:2059666-2059688 CGGGGCAGGTGGGGGCGCGGGGG - Exonic
969240326 4:5892990-5893012 GCGGGCAGGCGGGAGCGCGGTGG - Exonic
969401623 4:6959459-6959481 CCGGGCTGGTGTGAAGGCTGTGG + Intronic
969844822 4:9912139-9912161 CTGGGGTGGGGGGAGCGGGGAGG + Intronic
973531888 4:51843472-51843494 CCGGCCTGCGGGGAGGGCGGAGG + Intronic
974069442 4:57110454-57110476 CCGGGGCGGTGAGAGCACGGGGG + Intergenic
974445150 4:61971299-61971321 GTGGGGTGGTGGGAGCGGGGAGG - Intronic
975121227 4:70730697-70730719 CCAGGCTGGAGTGAGTGCGGTGG - Intronic
975585126 4:75941119-75941141 GCGGGCTAGTGGATGCGCGGCGG - Intronic
975612141 4:76213729-76213751 CCGGGCGGATGGGGCCGCGGAGG + Exonic
975776100 4:77789295-77789317 CGGGGTTGGGGGGAGCGTGGGGG - Intronic
977525697 4:98143156-98143178 TCGGGGTGGTGGGGGCGCTGGGG + Exonic
977908281 4:102501639-102501661 CGGGGCGAGCGGGAGCGCGGCGG - Exonic
980930285 4:139177451-139177473 GCGGGCTGGTGGGGGCCCGAGGG - Intergenic
982008796 4:151087279-151087301 CCAGGCTGGTTGGAGTGCAGTGG - Intergenic
984803738 4:183735851-183735873 CCGGGCCGGGGGGAGGGGGGGGG - Intergenic
985478408 5:92331-92353 AGGGGCGGGTGGGGGCGCGGGGG + Intergenic
985478437 5:92384-92406 AGGGGCGGGTGGGGGCGCGGGGG + Intergenic
985478476 5:92467-92489 AGGGGCGGGTGGGGGCGCGGGGG + Intergenic
985580463 5:693151-693173 GGGGGCTCGGGGGAGCGCGGGGG + Intronic
986152562 5:5140546-5140568 CCGCGCTGGTGGGAGCGCCCGGG - Intronic
987258294 5:16179586-16179608 CCGGGCCGGCAGGAGGGCGGCGG - Exonic
991666123 5:69001652-69001674 TGGGGTTGGTGAGAGCGCGGGGG - Intergenic
993385037 5:87252537-87252559 GCGGGCTGCAGGGAGCGGGGAGG + Intergenic
994508502 5:100672863-100672885 GCGGGGTGGTGGGAGTGGGGAGG + Intergenic
995614114 5:113941860-113941882 CTGGGGTGGTGGGAGGGGGGAGG + Intergenic
996955715 5:129181228-129181250 GTGGGGTGGTGGGAGCGGGGAGG - Intergenic
998176329 5:139904276-139904298 CCGGGTTTCTGGGCGCGCGGAGG + Intronic
998347575 5:141477826-141477848 TCGGCCAGGTGGGAGCTCGGTGG + Exonic
998370170 5:141655754-141655776 TCGTGCTGGTGGGAGCGTGAGGG + Exonic
1000065447 5:157690177-157690199 CCCGGCTCGTGGCAGCGCGGAGG - Intergenic
1000296397 5:159916613-159916635 CCGGGCTCGCGGGGGAGCGGCGG - Intergenic
1000858652 5:166430594-166430616 CCGGGTTGGGGGGAGGGGGGAGG - Intergenic
1001496073 5:172188370-172188392 CCGGGCCGGTGGGCGGGCGCGGG - Exonic
1001641663 5:173248388-173248410 CCGTTCTGGTGGGGGCGTGGGGG + Intergenic
1001773416 5:174312021-174312043 CCGGGCGCGCGGGGGCGCGGGGG + Intergenic
1002184160 5:177446612-177446634 CCTGGCGGGTGTGAGCCCGGCGG + Intronic
1002516794 5:179764922-179764944 CCAGGCTGGGTGGAGTGCGGTGG - Intronic
1002783491 6:384250-384272 CTGGGCTGCTGGGAGCACTGTGG + Intergenic
1003252840 6:4446886-4446908 CCCGGGTGGTGGGAGGGGGGAGG - Intergenic
1003290732 6:4776474-4776496 GCGGGCTGGGGCGGGCGCGGCGG - Exonic
1003539597 6:7006660-7006682 CAGGGCTGGTGGGAGCTGGAAGG - Intergenic
1003680419 6:8247980-8248002 GTGGGGTGGTGGGAGCGGGGAGG - Intergenic
1005102961 6:22193282-22193304 CAGGGGTGGGGGGAGCGGGGAGG + Intergenic
1005546236 6:26875528-26875550 CGGGGTTGGGGGGGGCGCGGGGG + Intergenic
1007413274 6:41677593-41677615 CAGGCCTGGTGGGAGAGTGGGGG - Intergenic
1008030426 6:46688226-46688248 GGGGGCTGGTGGGCGAGCGGCGG + Exonic
1009521737 6:64690828-64690850 CTGGGGTGGGGGGAGCGGGGAGG + Intronic
1011603650 6:89081521-89081543 TCGGGCGGGTGGGGGCGGGGTGG + Intronic
1013369307 6:109455771-109455793 CTGAGCGGGTGGGAGGGCGGGGG + Exonic
1013472416 6:110476843-110476865 CGGGGCGGGTGGGAGAGCGGCGG - Intergenic
1014551013 6:122789603-122789625 CACGGCTGGTGGGCGCGGGGAGG + Intronic
1015799263 6:137044459-137044481 CGGGGCTGCAGGGAGCCCGGGGG - Intronic
1017721537 6:157246481-157246503 CCCCGCTGGTGGGAGGGCCGGGG - Intergenic
1019197288 6:170290059-170290081 GCGGGCAGGTGGGGGCGCCGCGG - Intronic
1019456588 7:1130708-1130730 CCGGGCGGGTGGGGGCGGGGGGG + Intronic
1019562546 7:1665824-1665846 CCGGGCAGGCGGGGGAGCGGCGG - Intergenic
1019693942 7:2434099-2434121 GCGGGCGGGTGGGCGGGCGGAGG - Exonic
1019715898 7:2539199-2539221 CAGGGCTGGTGGGGGCGTGCAGG + Exonic
1019743850 7:2688673-2688695 CCGGGCTGGGGCGAGCCAGGTGG + Intronic
1020130483 7:5556288-5556310 CCGGGCAGCGGGGAGCCCGGGGG + Intronic
1021577319 7:22116253-22116275 CCAGGCTGGAGGGAGAGCAGTGG + Intergenic
1023287103 7:38631392-38631414 CGGGGCTGGCGGCGGCGCGGAGG + Exonic
1023877411 7:44294457-44294479 CAGGGATGGTGGGAGTGCTGGGG + Intronic
1024043912 7:45574776-45574798 CCGAGCTGCTGGGCGCGCCGGGG + Exonic
1024089102 7:45921044-45921066 GCGGGCTGGCGCGAGCTCGGCGG - Exonic
1026732783 7:72925662-72925684 GAGGGCGGGGGGGAGCGCGGCGG - Intronic
1027111308 7:75442248-75442270 CCGGGCGGGCGGGTGGGCGGCGG + Intronic
1027458840 7:78426455-78426477 GTGGGGTGGGGGGAGCGCGGAGG + Intronic
1028567073 7:92245726-92245748 GGGCGCGGGTGGGAGCGCGGGGG - Intronic
1029074943 7:97928035-97928057 CGGGGGTGCCGGGAGCGCGGGGG - Intergenic
1029849336 7:103446083-103446105 CCGGGCTGGTGAGTGCGCGCGGG - Exonic
1030051438 7:105541180-105541202 CCAGGCTGGATGGAGTGCGGTGG + Intronic
1030367027 7:108657478-108657500 CGGGGCTGGTGGGGGCCCGCCGG + Intergenic
1031051981 7:116953858-116953880 CCGGGCAGCTGGGCGCGCGGGGG + Intronic
1032013538 7:128361546-128361568 CCCGCCTGGTGAGAGCGCTGCGG - Exonic
1032090789 7:128910537-128910559 CCGGGCTGATAGGAGGGAGGGGG + Intronic
1033165424 7:139035474-139035496 CCCAGCTGCTGGAAGCGCGGGGG + Intronic
1033477014 7:141701727-141701749 CCGGGCTTGGGGAAGGGCGGGGG - Intronic
1034253725 7:149713545-149713567 CCGGGCCGGAGGGTGGGCGGTGG + Intergenic
1034478858 7:151304392-151304414 CGGTGCTGGCGGGAGCGTGGGGG + Intergenic
1034692939 7:153028509-153028531 CAGGGCTGGTGGGAGGGGAGAGG - Intergenic
1034977726 7:155457924-155457946 CCGGGCGGGCGTGAGCGCCGGGG + Intergenic
1035222410 7:157414070-157414092 CCGGGATGGTGGGGGAGGGGCGG - Intronic
1035721024 8:1791947-1791969 CCATGCTAGTGGGTGCGCGGTGG + Intergenic
1036242574 8:7092345-7092367 CGGGGCTGCCGGGGGCGCGGAGG + Intergenic
1036701394 8:11016058-11016080 CGGGGCTTGTGGGGGCGCAGTGG - Intronic
1037490481 8:19392779-19392801 CCAGGCTGGAGGGAGTGCAGTGG + Intronic
1037823625 8:22147828-22147850 GCGGGGTGCTGGGAGCGAGGGGG - Exonic
1038848414 8:31251285-31251307 CCGGTCAGATGGGAGCGCCGTGG + Intergenic
1039325526 8:36481266-36481288 GTGGGGTGGTGGGAGCGGGGAGG + Intergenic
1041016061 8:53594402-53594424 CAGGGCTGTCGGGAGCGCCGTGG - Intergenic
1043388151 8:79768010-79768032 CCGGGCAGGGGCGGGCGCGGAGG - Intergenic
1044719830 8:95134249-95134271 CCGGGCTGGCGGGACGGCGGCGG - Intronic
1045305275 8:100952207-100952229 CCGCGCTGGAGGGCGAGCGGAGG + Intronic
1048214297 8:132481002-132481024 GGGCGCGGGTGGGAGCGCGGAGG - Intergenic
1049208001 8:141372282-141372304 CCGGGGTGGTGGGAGCCCAGTGG - Intergenic
1049218409 8:141418024-141418046 CCTGGCAGGTGGGGACGCGGCGG + Intronic
1049671873 8:143873592-143873614 CTGGGCTGGCGGGAGGGCGTTGG - Intronic
1049867872 8:144950633-144950655 GGGGGGTTGTGGGAGCGCGGGGG - Intronic
1050151255 9:2621717-2621739 GCGGGCGGGCGGGAGCGCGGCGG - Intergenic
1052694854 9:31864883-31864905 GCGGGGTGGTGGGAGGGGGGAGG - Intergenic
1053049748 9:34950306-34950328 CCAGGCTGGAGGGAGTGCAGTGG - Intergenic
1053538378 9:38948291-38948313 CCAGGCTGGCTGGAGTGCGGTGG - Intergenic
1054627757 9:67415628-67415650 CCAGGCTGGCTGGAGTGCGGTGG + Intergenic
1054906608 9:70419030-70419052 CTGGGCCGGTCGGAGCGCGGGGG - Intergenic
1055757873 9:79573523-79573545 CTGGGCTGTTGGGCGCGAGGAGG + Intronic
1057168418 9:92946136-92946158 CCAGGCTGGATGGAGTGCGGTGG + Intergenic
1057594989 9:96408061-96408083 GCGGGGTGGCGGGAGCGGGGAGG + Intronic
1057802884 9:98200555-98200577 GCGGGGTGGTGGGGGGGCGGGGG + Intronic
1058176005 9:101737639-101737661 CCGGGCTTACGGGAGCCCGGCGG + Exonic
1058284734 9:103162681-103162703 GTGGGGTGGTGGGAGCGTGGAGG + Intergenic
1058467499 9:105244439-105244461 CCGTGCTGGTGGCAGGGCGGCGG - Intergenic
1058687245 9:107489632-107489654 ACGGGCGGGTGGGAGGGTGGGGG + Exonic
1058802171 9:108555229-108555251 CCTGGCTGGTGGGAGTGGGAGGG + Intergenic
1060596228 9:124850787-124850809 CCGGGCTGGCTGGAGTGCAGTGG - Intergenic
1060817722 9:126644125-126644147 CGGGGCTGGTGGGCCCGCGCTGG + Intronic
1061061055 9:128250760-128250782 CCGGGCTGGGGGCACGGCGGGGG - Exonic
1061371011 9:130197599-130197621 CCTGGCTGGCGGGAGGGCTGGGG + Intronic
1061843739 9:133375650-133375672 CCGGGCTGGCTGGAGGGTGGGGG + Intronic
1062009769 9:134260777-134260799 CCGTGCTGGTGAGGGCGCTGGGG + Intergenic
1062100048 9:134723268-134723290 CCGGGTTGGAGGGGGCTCGGCGG + Intronic
1062272094 9:135714367-135714389 CCGGGCTGGGGCTAGGGCGGGGG - Intronic
1062289211 9:135787059-135787081 CCTGGCTGCTGGGAGGGCTGGGG - Intronic
1062398559 9:136362584-136362606 CCTGGCTGCTGGGAGAGCAGTGG - Intronic
1062696498 9:137878520-137878542 CCGTGCAGGTGCGAGCGCTGTGG + Intronic
1185641767 X:1592410-1592432 CCGGGGTGGTCGGAGGGCGCTGG + Intronic
1185681755 X:1894147-1894169 CCGGGCTGGTAGGAGGGCAGTGG - Intergenic
1185877695 X:3713540-3713562 CCGGGCTGGGGGGGGCGAGGCGG + Exonic
1187006745 X:15240037-15240059 CAGGGCAGGTGGGGGGGCGGGGG + Intronic
1189322320 X:40094479-40094501 CCGGGCTGGTGGGAGCGCGGGGG - Intronic
1190133065 X:47768770-47768792 CCGGGCAGGTGGGGGTGGGGGGG - Intergenic
1190385450 X:49879387-49879409 CCCGGCCTGAGGGAGCGCGGTGG - Intergenic
1190415438 X:50176044-50176066 GTGGGGTGGTGGGAGCGGGGAGG + Intergenic
1192201058 X:69067030-69067052 CAGGGCTGGTGGGACCTTGGAGG - Intergenic
1193367897 X:80656566-80656588 TTGGGGTGGTGGGAGCGGGGAGG + Intergenic
1195802813 X:108732913-108732935 CGGGGCTGCGGCGAGCGCGGAGG + Exonic
1199716172 X:150508658-150508680 TGGGGCTGGTGGGAGTGGGGCGG - Intronic
1199846435 X:151695361-151695383 CCGGGGCGGTGGGAGGGCAGCGG + Intronic
1200183389 X:154165555-154165577 CCAGGCTGGAGGGAGTGCAGTGG - Intergenic
1200189043 X:154202669-154202691 CCAGGCTGGAGGGAGTGCAGTGG - Intergenic
1200194798 X:154240527-154240549 CCAGGCTGGAGGGAGTGCAGTGG - Intergenic
1200200448 X:154277613-154277635 CCAGGCTGGAGGGAGTGCAGTGG - Intronic
1201908502 Y:19109063-19109085 CTGGGTTGGTGGGAGGGTGGAGG - Intergenic