ID: 1189322423

View in Genome Browser
Species Human (GRCh38)
Location X:40094961-40094983
Sequence AGCGCCTCAAAGGACAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189322416_1189322423 30 Left 1189322416 X:40094908-40094930 CCCATTGATCCGGAGAACACTTC No data
Right 1189322423 X:40094961-40094983 AGCGCCTCAAAGGACAGCGCTGG No data
1189322419_1189322423 8 Left 1189322419 X:40094930-40094952 CCTAATTAACTCTCAGTCACCTA No data
Right 1189322423 X:40094961-40094983 AGCGCCTCAAAGGACAGCGCTGG No data
1189322417_1189322423 29 Left 1189322417 X:40094909-40094931 CCATTGATCCGGAGAACACTTCC No data
Right 1189322423 X:40094961-40094983 AGCGCCTCAAAGGACAGCGCTGG No data
1189322418_1189322423 21 Left 1189322418 X:40094917-40094939 CCGGAGAACACTTCCTAATTAAC No data
Right 1189322423 X:40094961-40094983 AGCGCCTCAAAGGACAGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189322423 Original CRISPR AGCGCCTCAAAGGACAGCGC TGG Intronic