ID: 1189324663

View in Genome Browser
Species Human (GRCh38)
Location X:40105330-40105352
Sequence CTGCGGCGGCGGCGGCGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2680
Summary {0: 2, 1: 17, 2: 233, 3: 618, 4: 1810}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189324663_1189324672 -10 Left 1189324663 X:40105330-40105352 CCGCCCCGCCGCCGCCGCCGCAG 0: 2
1: 17
2: 233
3: 618
4: 1810
Right 1189324672 X:40105343-40105365 GCCGCCGCAGTCACGGGGACCGG 0: 1
1: 0
2: 0
3: 4
4: 86
1189324663_1189324676 14 Left 1189324663 X:40105330-40105352 CCGCCCCGCCGCCGCCGCCGCAG 0: 2
1: 17
2: 233
3: 618
4: 1810
Right 1189324676 X:40105367-40105389 AGCCCTCGCGCCGCCCCGAGCGG 0: 1
1: 0
2: 0
3: 7
4: 107
1189324663_1189324680 24 Left 1189324663 X:40105330-40105352 CCGCCCCGCCGCCGCCGCCGCAG 0: 2
1: 17
2: 233
3: 618
4: 1810
Right 1189324680 X:40105377-40105399 CCGCCCCGAGCGGCCTCCGCTGG 0: 1
1: 0
2: 1
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189324663 Original CRISPR CTGCGGCGGCGGCGGCGGGG CGG (reversed) Intronic
Too many off-targets to display for this crispr