ID: 1189328703

View in Genome Browser
Species Human (GRCh38)
Location X:40129708-40129730
Sequence CCACTCCTGCTCCCAAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189328703_1189328708 10 Left 1189328703 X:40129708-40129730 CCTTTCCTTGGGAGCAGGAGTGG 0: 1
1: 0
2: 1
3: 43
4: 257
Right 1189328708 X:40129741-40129763 TCTAAGAACAGACTCCTTGCCGG 0: 1
1: 0
2: 1
3: 14
4: 123
1189328703_1189328711 19 Left 1189328703 X:40129708-40129730 CCTTTCCTTGGGAGCAGGAGTGG 0: 1
1: 0
2: 1
3: 43
4: 257
Right 1189328711 X:40129750-40129772 AGACTCCTTGCCGGGTGCGGTGG 0: 1
1: 0
2: 28
3: 222
4: 1683
1189328703_1189328710 16 Left 1189328703 X:40129708-40129730 CCTTTCCTTGGGAGCAGGAGTGG 0: 1
1: 0
2: 1
3: 43
4: 257
Right 1189328710 X:40129747-40129769 AACAGACTCCTTGCCGGGTGCGG 0: 1
1: 0
2: 5
3: 37
4: 349
1189328703_1189328709 11 Left 1189328703 X:40129708-40129730 CCTTTCCTTGGGAGCAGGAGTGG 0: 1
1: 0
2: 1
3: 43
4: 257
Right 1189328709 X:40129742-40129764 CTAAGAACAGACTCCTTGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189328703 Original CRISPR CCACTCCTGCTCCCAAGGAA AGG (reversed) Intronic
900135866 1:1116689-1116711 CCAGTCCCGCACCCAAGGCAGGG - Intergenic
900362866 1:2298399-2298421 CCACACCTGCTCCAAGGGAGAGG - Intronic
901104725 1:6746282-6746304 CCACTTCTGCTCCTTGGGAATGG + Intergenic
901636315 1:10671886-10671908 CCACACCTGCTCCCGTGAAAAGG - Intronic
901786686 1:11629524-11629546 CCACTTATGCTCCCAAGGACAGG + Intergenic
902246801 1:15126146-15126168 CCCCTTCTGCTCCAAAGGCAAGG + Intergenic
903059828 1:20661836-20661858 CAACTCCTCCTCCCTAGAAATGG - Intergenic
903233697 1:21936826-21936848 CCCCTCCTGGTCCCCAGGAATGG + Intronic
903333443 1:22609246-22609268 CCCCTCCTGCTCCCCACCAAAGG - Intergenic
903365631 1:22804030-22804052 CAACTCCTGCTCCCAGGGATTGG - Intronic
904046478 1:27612256-27612278 CCACCCCCGCTCCCAAAGGAAGG + Exonic
906112009 1:43330380-43330402 CCCCTCCCGCCCCCAGGGAAGGG + Intergenic
906534631 1:46544632-46544654 CCAATCCTGCACCCTAGAAAGGG + Intergenic
906875002 1:49527900-49527922 CCACACCTGATCCAAAGGAGTGG + Intronic
907259930 1:53210398-53210420 CACCTCCTGGTCCTAAGGAAAGG + Exonic
907926477 1:58959213-58959235 CCTCTCCTCCTCCAAAGGAACGG + Intergenic
907986269 1:59533923-59533945 CCTCTCCTCCTCCAAAGGAACGG + Intronic
909172661 1:72315786-72315808 CCCCTCCTACAACCAAGGAAGGG - Intergenic
909712907 1:78672881-78672903 GGACTCCTGCTCCTAGGGAAAGG - Intergenic
912900911 1:113647290-113647312 CAACTCCAGCTCCCTTGGAAGGG - Intronic
913445365 1:118944894-118944916 GCACTCCTCTTCCCAGGGAATGG + Intronic
914680394 1:149934858-149934880 CCCCTGCTTCTCTCAAGGAAAGG - Intronic
916189328 1:162163675-162163697 CCATTCCTGCCCCCCAGGAATGG - Intronic
919169693 1:193938498-193938520 ACACTGCTGCTGCCAAGGGACGG - Intergenic
919791169 1:201291864-201291886 GGACTGGTGCTCCCAAGGAAGGG - Intronic
920503287 1:206499014-206499036 CCACTGCTGCTCCCACGGCCAGG - Intergenic
920692125 1:208155063-208155085 GCAGTCCTGCTCCCTTGGAAAGG - Intronic
921052939 1:211524053-211524075 TCACTCCTGCTTCCAAGATAAGG + Intergenic
923074411 1:230596934-230596956 CATCTCCTGCTCCTATGGAAAGG + Intergenic
924508500 1:244709257-244709279 CCACACCTGCTCACAGGGAGGGG + Intergenic
924574697 1:245269227-245269249 CCCCTCCTCCTCCCACCGAACGG + Intronic
1062913033 10:1226458-1226480 CCTCTCCTCCTCCAAAGGAATGG - Intronic
1062929391 10:1342477-1342499 CTCCTCCTTCTCCCTAGGAATGG - Intronic
1063297142 10:4818002-4818024 CCTCTCCTGGACCCAAGGATGGG - Intronic
1067430635 10:46241190-46241212 CCACACATGCTGCCAAGGGAAGG + Intergenic
1069551713 10:69368708-69368730 GCACTACTGCCCCCCAGGAAGGG - Intronic
1069782251 10:70964312-70964334 CAGCTCCTGTTCCCAGGGAAGGG - Intergenic
1069868900 10:71521310-71521332 CCAATCCTGCTCCCAAGAGAGGG + Intronic
1071413577 10:85420695-85420717 CCACTCATGCTCTCAAGGCAAGG + Intergenic
1072717057 10:97759328-97759350 CTACTGCTGGTCCCAAGGACGGG - Exonic
1073050414 10:100663480-100663502 CCACCCCTGCTCCCAATATAGGG + Intergenic
1073238538 10:102037920-102037942 CAAGTCCTGCTCCCAAGCAGAGG + Intronic
1074751432 10:116591189-116591211 CCACTCCTGCCCCGTAGGAAGGG + Intronic
1075519346 10:123134886-123134908 CCACTCCTGGTCCCGGGGGAAGG + Intergenic
1075731967 10:124641713-124641735 CCTCTCTGGCTCCCAAGGAAGGG - Intronic
1076352951 10:129831321-129831343 CCACTCCTGCACCATAGGATGGG + Intergenic
1076519709 10:131073867-131073889 GCACACACGCTCCCAAGGAAAGG - Intergenic
1077225477 11:1437483-1437505 CCAGTCCTGCTCCGAGGTAAGGG - Intronic
1078873345 11:15369828-15369850 CCCCTCCTGCACCCCGGGAAAGG - Intergenic
1079758344 11:24295642-24295664 CCAGTCCAGATCCCAGGGAAGGG + Intergenic
1080058550 11:27932607-27932629 CCAATCCAGATCCCAAGGGAGGG + Intergenic
1080696198 11:34605054-34605076 CAACACGTGCACCCAAGGAATGG - Intergenic
1081274045 11:41124800-41124822 CCACTCTGGCTCCTAAAGAATGG - Intronic
1082596261 11:55085454-55085476 CCTCTCCTCCTCCAAAGGAATGG + Intergenic
1083406152 11:62458709-62458731 CCTCCACTGCTCCCAAGGACAGG + Intronic
1084530945 11:69727464-69727486 CCCCTCCTGCTCCCAGGGGGTGG + Intergenic
1084583287 11:70037948-70037970 CTACTCCTGCTGCAAAGAAAAGG + Intergenic
1084717917 11:70885263-70885285 CCACTCCATCCCCCACGGAAGGG - Intronic
1085266059 11:75238780-75238802 CCCCTGCTGCCCCCCAGGAAAGG - Intergenic
1085719098 11:78897538-78897560 CTACTGCTGCTCCCAAGCAGAGG + Intronic
1090178122 11:124669939-124669961 CCACACCTGCTCCTAATGACTGG + Intronic
1090302306 11:125653595-125653617 CCACTACTGATCCAAAGGAAAGG - Intronic
1090968959 11:131623264-131623286 CCATCCATGCTGCCAAGGAAGGG - Intronic
1092714862 12:11378245-11378267 CCTCTCCTCCTCCAAAGGAATGG + Intronic
1093489544 12:19689112-19689134 CCACTCCTGCTCTAAAACAAAGG - Intronic
1093978796 12:25452726-25452748 CCACTGCTCCTCCCCAGCAAAGG + Intronic
1096522201 12:52190859-52190881 CCACCTCTGCTCCCAGGGCAAGG - Intronic
1096580994 12:52585167-52585189 CCAGTCCTGCTCCCACACAATGG - Intergenic
1096819201 12:54220698-54220720 CCACTCCATCTCAAAAGGAAAGG + Intergenic
1099478629 12:83140094-83140116 CCACACCTGCCCCCAAGCAGAGG - Intergenic
1099904353 12:88754294-88754316 CCCCTCTAGCTCACAAGGAAAGG + Intergenic
1102675909 12:114658745-114658767 CGACTCCTGGTCTAAAGGAAGGG - Intergenic
1102719614 12:115004791-115004813 CCACTTCTGCTCCCAAGTAGAGG - Intergenic
1102764928 12:115423957-115423979 ACCCTCCTGCTCTCCAGGAAGGG - Intergenic
1105281066 13:18962860-18962882 CCACCCCAGCTTCCATGGAAGGG + Intergenic
1105418181 13:20231387-20231409 CCCTTCCTGCTCCCCAGGAAGGG + Exonic
1106762390 13:32879982-32880004 CTATTCCTGCACCCCAGGAATGG - Intergenic
1107019381 13:35735998-35736020 CCTCTCCTCTTCCCAAAGAATGG + Intergenic
1109255635 13:60077666-60077688 CCACTGCAACTCCCCAGGAAAGG + Intronic
1110533760 13:76627461-76627483 CCACTCCTGCTGGCAAGCAAGGG - Intergenic
1110800852 13:79692939-79692961 CTTCTCCTGCATCCAAGGAAAGG - Intergenic
1112018574 13:95351957-95351979 CCAATCCAGATCCCAAGGGAGGG + Intergenic
1112604180 13:100887937-100887959 GCCCTCCTGACCCCAAGGAAAGG - Intergenic
1113232535 13:108229791-108229813 CCACTGCTCCACCCAAGGAACGG - Exonic
1114425667 14:22620683-22620705 CCTCTCCTCCTCCAAAGGAATGG - Intergenic
1116932216 14:50702098-50702120 CTACTCCTGATCACCAGGAAGGG - Intergenic
1118177638 14:63457647-63457669 CCATCCCTGCTCCCAGGAAAGGG + Intronic
1120185659 14:81391431-81391453 CCACTCCTGCCCCCACATAATGG - Intronic
1120507634 14:85372418-85372440 GCACTCCTGCATCCAAAGAAAGG - Intergenic
1120644841 14:87061559-87061581 CCATTCAAGCACCCAAGGAAGGG + Intergenic
1121792041 14:96705804-96705826 CCACTGCTGATCCAAAGAAAGGG - Intergenic
1122027921 14:98891167-98891189 CCACTCCTTCTTCCAAGCGAAGG + Intergenic
1122884352 14:104703982-104704004 CCCCTCCTGCTCCCAAGGCCAGG + Intronic
1126656205 15:50980787-50980809 CCACACCTGGGCCCAATGAATGG - Intronic
1128699472 15:69793866-69793888 CCCCTCCTGCACCCAAGACAGGG - Intergenic
1129010136 15:72408474-72408496 CCACTGCTTCTCCCTAGGCAGGG + Intergenic
1129450156 15:75647252-75647274 CCACTCCTGCTCCGCAGGGACGG - Intronic
1129567007 15:76633647-76633669 CCACTCCTCCTCACCAGGCAAGG - Intronic
1129975253 15:79816271-79816293 CAACTCCTGCACCCAGGGAGTGG - Intergenic
1130821889 15:87504763-87504785 CCACCCCTGCTCCCTCGCAAGGG + Intergenic
1131565007 15:93477969-93477991 CAATTCCTGCTCCCAAGGAGGGG + Intergenic
1132386159 15:101401478-101401500 CGACGCCTGCTCCCAAGGGGAGG + Intronic
1133315188 16:4878575-4878597 TTACTTCTCCTCCCAAGGAAAGG - Intronic
1136640159 16:31557366-31557388 CCACTCCTGCTCACCTGGATCGG + Intergenic
1137330988 16:47495777-47495799 CCTTTCCTGCTTCAAAGGAAAGG - Intronic
1137899637 16:52252943-52252965 CCACTCCAGCTCACAAGAAGGGG - Intergenic
1138553069 16:57757698-57757720 CCCCTCCTGCTCCCAAGGCAGGG + Intergenic
1139420872 16:66848873-66848895 CCGCTCCTGCTTCCAGGGATGGG + Intronic
1140188336 16:72794060-72794082 CCTCTTCTGCACCCAACGAAGGG - Exonic
1140429194 16:74887073-74887095 ACACTCCTGCACACAAAGAATGG + Intronic
1140518234 16:75560022-75560044 CCAATCCAGATCCCAAGAAAGGG - Intergenic
1141341010 16:83203739-83203761 CCATTACTGTTCCCAGGGAAAGG - Intronic
1141950728 16:87337651-87337673 CCACACCTGCCCCTCAGGAAAGG + Intronic
1142518008 17:445867-445889 CCACTCCTTCGCCAAAGGACAGG + Exonic
1144024162 17:11262869-11262891 CAGCTCCTGCTATCAAGGAAGGG - Intronic
1144245389 17:13358171-13358193 CCACTCCTGCTAGCAAAGTATGG + Intergenic
1144949206 17:18984974-18984996 CCACTCCTGGTCCCCAGGTGAGG - Intronic
1145023878 17:19453270-19453292 AGCCTCCTGCCCCCAAGGAAGGG + Intergenic
1145993421 17:29092496-29092518 GCCCTCCTGCCCCCAAGGAATGG - Intronic
1147189271 17:38729552-38729574 CCCTCCCTGCTCCCTAGGAAGGG - Exonic
1147722792 17:42548988-42549010 CAACTCCTGAGCTCAAGGAATGG - Intergenic
1147724005 17:42555226-42555248 CAACTCCTGGGCTCAAGGAATGG - Intergenic
1150076286 17:62194904-62194926 CCACTCCTGATCCCACGGTACGG - Intergenic
1150606518 17:66696041-66696063 CACCTCTTGCTCCCCAGGAAGGG - Intronic
1151322229 17:73359064-73359086 CCAATCCTGCTCCCCACCAAAGG + Intronic
1152643972 17:81460447-81460469 CCAGACGGGCTCCCAAGGAAGGG + Intronic
1153460196 18:5324900-5324922 GAACTCCTGCTCCCAACCAAGGG + Intergenic
1155231406 18:23778608-23778630 GCACGCCTGCACCAAAGGAAGGG + Intronic
1160386759 18:78501540-78501562 CCCCTGCTGCTCCCTAGGAAGGG - Intergenic
1162036070 19:7940249-7940271 CCAGTGCTGCTCCCCAGGACAGG + Intronic
1162729870 19:12711844-12711866 CCACTCCTGCCTCCAGAGAAAGG + Intronic
1163020750 19:14479775-14479797 CCACTTCTGCTCCCAGGGGCTGG + Intronic
1163640710 19:18460542-18460564 CCCATCCTGCTCCCAAGGCTAGG - Intronic
1163672875 19:18638648-18638670 CCACTCCAGTGCCCAAGGCAGGG - Intronic
1163821769 19:19500104-19500126 CCTCTCCTGTTGCCAAGGATAGG + Intronic
1165102995 19:33449972-33449994 CCACTCCTGCACCCAAGCGGGGG - Intronic
1165326916 19:35119264-35119286 CCTCCCCTGCTCCCCAGGCAGGG - Intronic
1165385445 19:35507840-35507862 CCACTCCAGCTCCAAAGCCAGGG - Intronic
1165933895 19:39377597-39377619 CCACCCCTACTGCCAAGGATGGG + Exonic
1166007534 19:39917683-39917705 CCACCCCTGCTCCCCAGGCTGGG + Intronic
1167823095 19:51947971-51947993 CAACACCTGGTCCCAAGGACAGG - Intronic
1168711074 19:58500299-58500321 CCACCCCTGCCACCCAGGAAAGG + Intronic
925035998 2:686313-686335 CCACAGCTGCTCTCAAGGACTGG - Intergenic
925712235 2:6752711-6752733 CTCCCCCTGCTCCCAAGGAGAGG - Intergenic
927735832 2:25521219-25521241 CAACCCCTGCTCTCAAAGAAGGG - Intronic
929028726 2:37630410-37630432 CCACTGATGCTCTCAAGGGAGGG - Intergenic
931491587 2:62754042-62754064 CCTCTCCCCCTCCAAAGGAACGG - Intronic
932259725 2:70317127-70317149 GCACTTCTGCTCCCAAGGCCTGG - Intergenic
933131392 2:78677586-78677608 CCACTGTTGCTCCCAGGGATCGG - Intergenic
934634698 2:95973677-95973699 CCACTTCTGCTCCCAAACAGTGG + Intronic
936166217 2:110122054-110122076 CAGCTCCTGCTCCCAGGGAGAGG - Intergenic
939473936 2:142661398-142661420 CCATTCCTGGTCCCTAGAAAAGG + Intergenic
939729699 2:145766834-145766856 CCAATTCTGCACCCCAGGAAAGG + Intergenic
942613151 2:177762711-177762733 CCGCTCTTCCTCCCAGGGAAAGG + Intronic
943303316 2:186230165-186230187 CCACTTCTGCTCTCATGGACTGG - Intergenic
946908420 2:224437766-224437788 CCTCTCCTGCTACCTATGAAGGG + Intergenic
948427033 2:237894874-237894896 CCACTCCTGTTCCCCAGGGCTGG - Intronic
948657845 2:239487574-239487596 GCACTCCTGCTCCCATGGGTGGG - Intergenic
1170045819 20:12084445-12084467 CCACTCAGGCTACCGAGGAAAGG - Intergenic
1171312523 20:24156290-24156312 CCAGTGCTGCTCACTAGGAATGG - Intergenic
1172613133 20:36266439-36266461 CCACTCCTGCCCCAGAGGATTGG - Intronic
1173034668 20:39397073-39397095 CCATTTCAGCTCCCCAGGAATGG + Intergenic
1173187169 20:40849091-40849113 GCCTCCCTGCTCCCAAGGAAGGG + Intergenic
1173844975 20:46182561-46182583 CCACTCCTCCACCCCATGAAGGG + Intronic
1174060806 20:47831591-47831613 CCACACCTGCTCCCAGGCAAAGG + Intergenic
1174071092 20:47899779-47899801 CCACACCTGCTCCCAGGCAAAGG - Intergenic
1174152960 20:48498883-48498905 CCACACCTGCTCCCAGGCAAAGG + Intergenic
1174229011 20:49028869-49028891 CCACTCCTGGGCTCAAGCAAGGG - Intronic
1178048196 21:28719657-28719679 CCACTCCTACTCCCAGGGAGTGG - Intergenic
1179149862 21:38800643-38800665 CAGCCCCTGCTCCCAAGGTAGGG - Intergenic
1179603853 21:42499398-42499420 CCACTCCCACGCCCCAGGAAAGG - Intronic
1180056653 21:45362386-45362408 TCTCTCCTGCTCACAAGGAGGGG - Intergenic
1181546989 22:23607714-23607736 ACTCTCCTGATCCCATGGAAAGG - Intergenic
1181623427 22:24106269-24106291 CCAGACCTGCAGCCAAGGAAGGG - Intronic
1182114795 22:27749947-27749969 CAACTCCAGCACCCAAGGCACGG + Exonic
1182470724 22:30546675-30546697 CCACTCATGCTGCCCATGAATGG + Exonic
1182757158 22:32689478-32689500 CTTCTCCTGCTCTAAAGGAATGG + Intronic
1183329836 22:37213431-37213453 CCAGCCCTGGTCCCAGGGAATGG - Intergenic
1184878780 22:47291972-47291994 CCTCTCCTGCGGCTAAGGAAGGG - Intergenic
1185041338 22:48506029-48506051 ACAAACCTGCTCCCAAGAAAGGG - Intronic
949563757 3:5226593-5226615 CTTTTCCTGCTCCCAAGGAAAGG + Intergenic
950432445 3:12958668-12958690 CCCCTCGTGCTCCCCAGGTATGG - Intronic
950457902 3:13103502-13103524 CCACACCTGTCCCCGAGGAAGGG + Intergenic
950662965 3:14478008-14478030 CCTCCCCTGTTCCCCAGGAACGG + Intronic
951157704 3:19375655-19375677 CCTCTCCTCCTCCAAAGGAACGG - Intronic
953103627 3:39854669-39854691 TCACACCAGCTCCCAAGCAATGG - Intronic
953116281 3:39995130-39995152 CCTCTCCTCCTCCAAAGGAACGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953353020 3:42230252-42230274 AGACTCCTGGTCCCAAGGAGGGG - Intergenic
955772933 3:62404742-62404764 CCCCTCCTGCTCCCTGGGGAGGG - Intronic
955825445 3:62941433-62941455 ACACTTGTGCTCCCAAGGGAAGG + Intergenic
955933300 3:64079130-64079152 CCACCTCTGCTCCAAAGCAAGGG + Intergenic
959528757 3:107408323-107408345 CGAGTCCTCCTCCCAGGGAAAGG + Intergenic
959532599 3:107450751-107450773 CCATTCCTGCTCCCAGGGCTGGG - Intergenic
960593876 3:119390884-119390906 ACCATCCTGCTCGCAAGGAAAGG + Exonic
961171659 3:124801728-124801750 CAACTCCTGCCACCAAAGAATGG + Intronic
963032133 3:140988645-140988667 CCTCTCCCCCTCCAAAGGAATGG + Intergenic
967954797 3:194869819-194869841 CCACAGCAGCTCCCAAGGCAGGG - Intergenic
968890267 4:3365022-3365044 CCCCTTCTGCTCCCCTGGAAAGG - Intronic
969258750 4:6020900-6020922 TCAGGGCTGCTCCCAAGGAAGGG - Intergenic
971264487 4:25085823-25085845 CCAGCCCTGCTCCCCAGGAGTGG + Intergenic
972142875 4:35983022-35983044 CCACACCAGCTCCCCAGCAATGG + Intronic
973534310 4:51866055-51866077 GCACTCCTTCTTCCAGGGAAAGG + Intronic
973625966 4:52773213-52773235 CCTCTTCTCCTCCAAAGGAATGG - Intergenic
973711709 4:53636204-53636226 CCACTCCTTCTCCCCTGAAAAGG - Intronic
975861354 4:78680457-78680479 CCACTTCTGGTCCCTAGGCAAGG + Intergenic
977288544 4:95138965-95138987 CCTCTTCTCCTCCAAAGGAAGGG - Intronic
981270650 4:142845248-142845270 AAACTACTGCCCCCAAGGAAGGG + Intronic
985681249 5:1257020-1257042 CCACTCCTGCCTCGAGGGAAGGG + Intronic
986668482 5:10123700-10123722 CCTCCCCTGCACTCAAGGAAGGG + Intergenic
988066093 5:26229910-26229932 TCACTCCTGCACCCATGGCATGG + Intergenic
988706542 5:33731543-33731565 GCACTCCAGCTCCACAGGAAGGG + Intronic
989832414 5:45937177-45937199 CAACTGCTGCATCCAAGGAAAGG - Intergenic
990269161 5:54116146-54116168 CCCCTCCTGCTCCCCAGGGATGG - Intronic
990726800 5:58765195-58765217 CACCTCCTGCTCCCAAGGTGAGG + Intronic
990921948 5:60978031-60978053 CCACAGCTGCTACCAGGGAATGG - Intronic
995362672 5:111316202-111316224 CCATTCCTGCTCCACAGTAACGG + Intronic
996516147 5:124371920-124371942 CCTCTCCAGCTGCCAAGGCAAGG - Intergenic
996904215 5:128578789-128578811 CCACTCCTGTGTACAAGGAAAGG - Intronic
997979436 5:138459710-138459732 CCTCTCCTGTTTGCAAGGAAAGG + Intergenic
1002278510 5:178117965-178117987 CCACTCCTGCCCCCGAACAATGG - Intronic
1002469880 5:179428876-179428898 CCACTCCGGCTAACAAGGAGAGG + Intergenic
1003047109 6:2744033-2744055 CCACAGCTGCTCCCAAAGAATGG - Intronic
1003207094 6:4022191-4022213 CCACTCGTCCTCCTAAAGAAGGG - Intronic
1004196785 6:13512518-13512540 CCATACCTCCTCCCAAGCAAAGG - Intergenic
1006432727 6:34007783-34007805 CCCCTCCTGCTCTCAGTGAAAGG - Intergenic
1007228552 6:40331840-40331862 CCCCTCCTGCTCCCCAAGAGTGG + Intergenic
1007368283 6:41409440-41409462 CCACCCTTGCTCGCAGGGAAAGG - Intergenic
1007745794 6:44042346-44042368 CCACACCTGCTACAAAGGCAGGG + Intergenic
1008686314 6:53929765-53929787 TCACACCTGCAGCCAAGGAAGGG - Intergenic
1009485846 6:64220569-64220591 AGAGTCCTTCTCCCAAGGAAGGG - Intronic
1009906282 6:69873341-69873363 ACACTCCTAGGCCCAAGGAATGG + Intronic
1011802754 6:91036418-91036440 CCCCACCTTCTCCCAAGGATGGG - Intergenic
1013448067 6:110251147-110251169 CCACTCCTCCTCTCAAGGGCTGG - Intronic
1016311149 6:142734777-142734799 TCACTCTTGCTGCCCAGGAATGG - Intergenic
1016425520 6:143932686-143932708 CCACACCAGCTCCCCAGCAATGG - Intronic
1018294645 6:162332480-162332502 CCATTCCTGCTCCCTTGGATTGG + Intronic
1018736525 6:166690640-166690662 CCCCTCCTGCCCCCAGGGAGCGG - Intronic
1019343923 7:520553-520575 CCACTCCCGCGCCGAAGGCAGGG + Intergenic
1019792832 7:3028321-3028343 CCACCCCCTCTCCCATGGAATGG + Intronic
1021143325 7:17054020-17054042 CCTCTCCTCCTCCAAAGGAATGG + Intergenic
1022575991 7:31497682-31497704 CCACCACTGCTCCCCAGGAATGG + Intergenic
1024704529 7:51942333-51942355 CCTCTTCTCCTCCAAAGGAATGG + Intergenic
1026875786 7:73878384-73878406 CCACCCCTGGTCCCCAGGACCGG + Intergenic
1029459271 7:100686041-100686063 CAGCTCCTGCTCCTCAGGAATGG + Exonic
1029507617 7:100971754-100971776 CCATCCCTGCTCCCAAGGCCTGG + Intronic
1031231908 7:119118139-119118161 CCACTACTGCTCCTAAGGTAAGG + Intergenic
1031435148 7:121724385-121724407 CCTCTCCCCCTCCAAAGGAACGG - Intergenic
1032147274 7:129395474-129395496 CCTCTCCAGCTCTCCAGGAAGGG - Intronic
1033250378 7:139753389-139753411 TCACTGCTGGTCCCAAGGAATGG - Intronic
1035105674 7:156440185-156440207 CCACGGCTGCTCCCTGGGAATGG + Intergenic
1035257201 7:157638272-157638294 CCAAACGTGCTCACAAGGAACGG + Intronic
1035288808 7:157824188-157824210 CAAGTCCTCCTCCCAAGGCAGGG + Intronic
1035361785 7:158318237-158318259 CCACTCCTGCTTGCACTGAATGG - Intronic
1036544056 8:9749409-9749431 CCAGTTCTGCTCCCAGGGAGTGG + Intronic
1036597484 8:10227049-10227071 CCACAGCTGCTCCCCAGGGATGG - Intronic
1036795548 8:11753924-11753946 GCAGTCCTGCTCCCCAGGACTGG + Intronic
1037693907 8:21207412-21207434 TCACTAATGCCCCCAAGGAAGGG + Intergenic
1039840440 8:41289158-41289180 CACCTCCTGCTCCCCAGGCAAGG - Intronic
1040793128 8:51256991-51257013 CCAGTCCTGCCCCCATTGAAAGG + Intergenic
1041147381 8:54891350-54891372 CCTCTCCTGGTGACAAGGAAGGG + Intergenic
1044568132 8:93687741-93687763 CCATACCTTCTTCCAAGGAATGG + Intergenic
1045005798 8:97915555-97915577 CCCCTCCTCCTTCCAGGGAAAGG + Intronic
1045403903 8:101846169-101846191 CCACTGCTGATCCAAAAGAAAGG - Intronic
1046724428 8:117658953-117658975 CCACTCCTTCCCCCAAGCCAAGG - Intergenic
1048572857 8:135669474-135669496 CACCTCTTGCACCCAAGGAAGGG + Intergenic
1049028369 8:140013329-140013351 CCACTCCTGACCCTAAGGAAAGG + Intronic
1050395231 9:5188419-5188441 CCACTCCTCCTCACCAGGCAGGG - Intergenic
1051160628 9:14203660-14203682 CCAACCCTGCTACCAAGGCAGGG + Intronic
1051728849 9:20117146-20117168 CCACACCTGCTTACAAGGGAAGG - Intergenic
1052278332 9:26703990-26704012 GCACTCCACCTCCAAAGGAAAGG + Intergenic
1052494831 9:29213036-29213058 CCCCTCCTGATCCCTTGGAAAGG - Intergenic
1053150588 9:35740460-35740482 CCACCCCTGGTCCCAAGACAGGG + Intronic
1053498386 9:38565280-38565302 CCACGGCTGCTCTCAAGGACTGG - Intronic
1055708170 9:79031412-79031434 CCACTCCTCCTCCAAAAGAAGGG + Intergenic
1055981513 9:82007230-82007252 CTACCCCTGCTCCCAAGCCAAGG - Intergenic
1056685126 9:88752781-88752803 CCACTCCAGCTCTAAAGGGATGG - Intergenic
1058103127 9:100938326-100938348 CCACTCCTCCTCTCCAGGAAAGG - Intergenic
1058763286 9:108157561-108157583 GCACCCTTGCTACCAAGGAAGGG - Intergenic
1059142185 9:111864117-111864139 CCACTCCTCTCCCAAAGGAATGG + Intergenic
1059695174 9:116723809-116723831 CCATACTTGCTCCCAAGAAAAGG - Intronic
1060399640 9:123340713-123340735 CCCCTCCAGCCCCCAAGGAAAGG - Intergenic
1060745896 9:126130781-126130803 CCATTACTGCTACCAAGGGAAGG + Intergenic
1060775092 9:126367254-126367276 CCCCTCTTGCTCCCTAGGATGGG + Intronic
1061019358 9:128004160-128004182 CCAAGCCTCCTCCCAGGGAATGG - Intergenic
1061317215 9:129803656-129803678 CCACCTGTGATCCCAAGGAACGG - Intronic
1061630533 9:131869532-131869554 GCACTAATGCTCCCAAGGAGAGG + Intronic
1062119965 9:134829230-134829252 CCCCTGCTGCTGCCCAGGAAGGG - Intronic
1062485708 9:136774323-136774345 CCACACCTGCTCCCAGGTGAAGG + Intergenic
1189328703 X:40129708-40129730 CCACTCCTGCTCCCAAGGAAAGG - Intronic
1189332766 X:40153510-40153532 CCTTTCCTGCATCCAAGGAAGGG + Intronic
1189348769 X:40261978-40262000 CCTCTCCTGCTCCCAACAGAGGG + Intergenic
1192428974 X:71100068-71100090 CCAAACCTGCACTCAAGGAAAGG + Intronic
1192678461 X:73225415-73225437 GCACTCCAGTTCCCAAGGAAAGG - Intergenic
1194513471 X:94822597-94822619 CCCCTCCTGCAGCCAAGAAAAGG - Intergenic
1195663450 X:107405488-107405510 ACACTCCTTGTCCCAAGAAAAGG + Intergenic
1198421959 X:136477236-136477258 CCCCTGCTGCTGCCAAGGCAAGG + Intergenic
1198975334 X:142329071-142329093 CCTCTCCAGATCCCAAGAAAGGG - Intergenic
1199700798 X:150374070-150374092 CCACTCCTGCTTCAGAGGATAGG - Intronic
1200329590 X:155282391-155282413 CCTCTTCTTCTCCCAAGCAAAGG - Intronic
1201781822 Y:17731393-17731415 CCACTGCTGCTCCCCATGGATGG - Intergenic
1201819731 Y:18174597-18174619 CCACTGCTGCTCCCCATGGATGG + Intergenic