ID: 1189328778

View in Genome Browser
Species Human (GRCh38)
Location X:40130148-40130170
Sequence TAGATGAAGAGGGACAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 865
Summary {0: 1, 1: 0, 2: 8, 3: 70, 4: 786}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189328778_1189328785 11 Left 1189328778 X:40130148-40130170 CCTTCCCTGTCCCTCTTCATCTA 0: 1
1: 0
2: 8
3: 70
4: 786
Right 1189328785 X:40130182-40130204 GGTGGAGAGCAGCCTGATTAAGG 0: 1
1: 0
2: 2
3: 13
4: 155
1189328778_1189328786 12 Left 1189328778 X:40130148-40130170 CCTTCCCTGTCCCTCTTCATCTA 0: 1
1: 0
2: 8
3: 70
4: 786
Right 1189328786 X:40130183-40130205 GTGGAGAGCAGCCTGATTAAGGG 0: 1
1: 0
2: 0
3: 11
4: 123
1189328778_1189328784 -7 Left 1189328778 X:40130148-40130170 CCTTCCCTGTCCCTCTTCATCTA 0: 1
1: 0
2: 8
3: 70
4: 786
Right 1189328784 X:40130164-40130186 TCATCTAAATCTTCAACAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 149
1189328778_1189328783 -10 Left 1189328778 X:40130148-40130170 CCTTCCCTGTCCCTCTTCATCTA 0: 1
1: 0
2: 8
3: 70
4: 786
Right 1189328783 X:40130161-40130183 TCTTCATCTAAATCTTCAACAGG 0: 1
1: 0
2: 2
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189328778 Original CRISPR TAGATGAAGAGGGACAGGGA AGG (reversed) Intronic
900243525 1:1627643-1627665 GAGAGGAAGTGGGAGAGGGAGGG - Intronic
900518823 1:3095964-3095986 TGGAGGAGGAGAGACAGGGAGGG - Intronic
900558171 1:3290375-3290397 TAGATGAGGAGGCACAGAGAGGG + Intronic
900562672 1:3315183-3315205 GAGAGGGAGAGGGAGAGGGAGGG - Intronic
900662393 1:3791310-3791332 TACACGAAGAGGGAAAGAGATGG - Intronic
900713259 1:4128402-4128424 TAGACAAAGAGAGACAGAGACGG - Intergenic
900797996 1:4720972-4720994 GAGAGGATGGGGGACAGGGATGG + Intronic
900847037 1:5112364-5112386 GAGAGGAAGAGGGAGAGGAAGGG + Intergenic
900847073 1:5112493-5112515 GAGAGGCAGAGGGAGAGGGAGGG + Intergenic
901020043 1:6250751-6250773 TAGCTGAAAAGGGAATGGGAGGG + Intronic
901036946 1:6341974-6341996 TAGATGAAGAGAGAAAAGCAGGG - Intronic
901863400 1:12088887-12088909 AGGATGAAGAGGGACTGGGCGGG - Intronic
902066856 1:13695528-13695550 TAAATGACGTGGCACAGGGATGG + Intergenic
902587449 1:17449131-17449153 TAGATGAGGTGGGCCAGGCATGG - Intergenic
902592393 1:17484388-17484410 GAGATGAAGAGGGAGAGGTAAGG + Intergenic
902652057 1:17843552-17843574 TAGAGGATGAGGAACAGGCAAGG - Intergenic
902694805 1:18133136-18133158 TAAAGGAAGAGGGAGGGGGAAGG + Intronic
902721322 1:18306200-18306222 AAGCTGAAGAGGGAGAGGGTAGG - Intronic
902787159 1:18740128-18740150 GAGAGACAGAGGGACAGGGAGGG + Intronic
902810832 1:18886874-18886896 TAGATGAAGAGACTTAGGGAAGG - Intronic
902811877 1:18892587-18892609 TAGAGGGAGAGGGAGAGGCAGGG + Intronic
902896012 1:19480607-19480629 TGGAAGAAGAGAGACAGGGCTGG - Intronic
902955644 1:19922767-19922789 GAGAGGGAGAGGGAGAGGGAGGG + Intronic
903769775 1:25756609-25756631 TGGGGGAAGAGGGACAGAGATGG + Intronic
904304561 1:29579651-29579673 TAGAGGAAGAGTGACAAGCAGGG - Intergenic
904440734 1:30527874-30527896 TGGAAGATGAAGGACAGGGAGGG - Intergenic
904858258 1:33516168-33516190 GAGATGAAGAGGGGGAGGTACGG - Exonic
905242387 1:36589242-36589264 GAGAGGAAGGGGGAGAGGGAAGG + Intergenic
905266934 1:36760732-36760754 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
905686801 1:39914033-39914055 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
905858603 1:41331165-41331187 TAGAGGAAGAGGGACAAGGAAGG + Intergenic
906073416 1:43034454-43034476 TAAAGGAAGAAGGAAAGGGAAGG - Intergenic
906112617 1:43334356-43334378 TAGGTGTAGAGGGAGAAGGAAGG + Intergenic
906290779 1:44617986-44618008 AAGCTGAAGAAGGCCAGGGAGGG - Intronic
907534580 1:55138310-55138332 TAGGTAAAGATGGACAGGGAAGG - Intronic
907791238 1:57666854-57666876 GAGAGGGAGAGGGAGAGGGAGGG + Intronic
908091647 1:60692135-60692157 CAGAGGAAGAGGGAGAGAGATGG - Intergenic
908549090 1:65191520-65191542 TAGATGAGTGGGGATAGGGAAGG + Intronic
908836369 1:68232625-68232647 TAGAGGAAGAGAGGGAGGGAGGG - Intronic
909604323 1:77493380-77493402 TATAAGCAGAGGAACAGGGAAGG - Intronic
909894963 1:81057394-81057416 TAGCTGGACTGGGACAGGGAGGG - Intergenic
911032146 1:93500487-93500509 TGGAAGAAGAGGAAGAGGGATGG + Intronic
911486875 1:98513657-98513679 GAGAGGGAGAGGGAGAGGGATGG + Intergenic
912252871 1:108029379-108029401 GAGAAGAAGAGGGAAGGGGAAGG + Intergenic
912331221 1:108821833-108821855 AAGAAGAAGAGGGAAAGGGAAGG - Intronic
912836589 1:113001744-113001766 AAGATGAAGAGGGCCAGGCGTGG - Intergenic
913056025 1:115160103-115160125 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
913212745 1:116595081-116595103 TGCATGCAGAGAGACAGGGAGGG + Intronic
914407469 1:147390037-147390059 TAGGGGAAGAGGGAGAGGGGAGG - Intergenic
915017639 1:152750237-152750259 TAGATGCATAGGGAGAGAGAAGG - Intronic
915270398 1:154749691-154749713 GAGAAAGAGAGGGACAGGGATGG + Intronic
915495165 1:156277298-156277320 GAGATGAACAGGGTAAGGGAGGG - Intronic
916003841 1:160641513-160641535 AAGAGGAAGAGGAAAAGGGAGGG + Intronic
916845407 1:168645107-168645129 TAGATCAAGAGGGTCGGGGGAGG + Intergenic
916955858 1:169833783-169833805 TAGAAGAAGTGGGACTGGGAGGG + Intronic
917064169 1:171073756-171073778 TAGAGGAAGAGGTACAGAGAAGG - Intergenic
917089327 1:171337047-171337069 CAGATGAAGAGAGACAGGGCAGG + Intronic
917176069 1:172236922-172236944 TAGAGGAAGAGGAAGAGGAAGGG - Intronic
918513198 1:185333848-185333870 AAGAAGAAGATGAACAGGGAAGG + Intergenic
919053730 1:192542937-192542959 AAGATGAAGAGAGAAAAGGAGGG + Intergenic
919434189 1:197536062-197536084 AAGAAGAAAAGGGACAGAGAGGG + Intronic
919450535 1:197767695-197767717 AAAATGAAAAGTGACAGGGAGGG + Intronic
919935092 1:202245962-202245984 TAGATGAAGGGAGGGAGGGATGG - Intronic
919935121 1:202246053-202246075 TAGATGAAGGGAGGGAGGGATGG - Intronic
919935240 1:202246384-202246406 TAGATGAAGGGAGGGAGGGAGGG - Intronic
920503654 1:206501304-206501326 GAGATGAAGAGGGATGGAGAGGG + Intergenic
920520596 1:206622038-206622060 TAGGGAAAGACGGACAGGGAAGG - Intergenic
920873696 1:209815338-209815360 TAGAGGAAGAGAGAAAGGAAGGG - Intergenic
920942340 1:210495567-210495589 TAGAGAAAGAGGGAGAAGGAGGG - Intronic
921097016 1:211895452-211895474 AAGAGGAAGAGGGAAGGGGAGGG - Intergenic
921902963 1:220467547-220467569 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
921978547 1:221229037-221229059 TAGAAAGAGAGGGACAGAGACGG + Intergenic
922095602 1:222440500-222440522 TGGAAGAGGAGGGAGAGGGAAGG + Intergenic
922504900 1:226120787-226120809 TGGATGCAGAGGGAATGGGAGGG + Intergenic
923468418 1:234268459-234268481 GAGAGGGAGAGGGAGAGGGAGGG + Intronic
923710596 1:236385898-236385920 GAGAGGGAGAGGGAGAGGGAGGG - Intronic
1062972299 10:1657897-1657919 CAGATAAAGAGAGACAGAGACGG - Intronic
1063173795 10:3533762-3533784 TCCATGAAGAGGATCAGGGAGGG - Intergenic
1063173814 10:3533832-3533854 TCCATGAAGAGGATCAGGGAGGG - Intergenic
1063601041 10:7481824-7481846 TGAAAGAAGAGGGAAAGGGAAGG + Intergenic
1063721532 10:8586938-8586960 AAGAGGGAGAGGGAGAGGGAAGG - Intergenic
1063810125 10:9695569-9695591 CAGATGATGAGGGACTGGTATGG - Intergenic
1064423537 10:15210596-15210618 TAGATGAGGAGGGACGAGGGAGG - Intergenic
1064525008 10:16246030-16246052 TAAAAGTAAAGGGACAGGGAAGG + Intergenic
1064688194 10:17886350-17886372 GAGAGGGAGAGGGAGAGGGAGGG - Intronic
1064957925 10:20931956-20931978 TAGATGAGGAAGACCAGGGAAGG - Intronic
1065285239 10:24181322-24181344 TAGATGAAGTGAGAGGGGGAAGG + Intronic
1065698259 10:28400474-28400496 GAGATAAAGAGGAACAGGGCCGG + Intergenic
1065728755 10:28691665-28691687 GAGGGGAAGAGGGAGAGGGAGGG - Intergenic
1065867760 10:29928414-29928436 GAGAGGGAGAGGGAGAGGGATGG + Intergenic
1066383037 10:34917964-34917986 TAGACTAACAGGGACAAGGAGGG - Intergenic
1067114248 10:43422643-43422665 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1067784164 10:49230282-49230304 AAGATGGAGAGGGACAGGAAAGG + Intergenic
1068788918 10:61006629-61006651 AAGATCAAAAGAGACAGGGAAGG - Intergenic
1068841481 10:61619697-61619719 TCAAGGGAGAGGGACAGGGAGGG - Intergenic
1069249678 10:66252976-66252998 CAGTTGAAGAGGGTAAGGGAGGG + Intronic
1069441548 10:68433229-68433251 GAGAGGATGAGGGAGAGGGAAGG - Intronic
1069570713 10:69492866-69492888 TAGGTGCAGAGGGACATGGTGGG + Intronic
1069607578 10:69749466-69749488 TAGATGGAGAGGCCCAGGCAAGG - Intergenic
1070092541 10:73302274-73302296 GAGATAAAGAAGGCCAGGGAGGG + Intronic
1070781281 10:79138665-79138687 CAGAAGAAGAGGGAGAGGCATGG - Intronic
1071112206 10:82172828-82172850 TAAAAGAAGGGAGACAGGGAGGG - Intronic
1071274218 10:84038092-84038114 TTGAAGAAGAGGAATAGGGAGGG + Intergenic
1071341050 10:84649413-84649435 AAGATGAAAAGGGACAAAGAAGG - Intergenic
1072003926 10:91223790-91223812 TAGATGTAGGGGGAGAGAGAAGG + Intronic
1072234813 10:93444573-93444595 AAGATAAAGAGTGACAGGGAGGG + Intronic
1072718292 10:97765826-97765848 TTGAGGTAGATGGACAGGGAGGG - Intergenic
1073508714 10:104027605-104027627 TATTTGAAGAGGGATTGGGAAGG + Exonic
1073849923 10:107602936-107602958 AAGAAGAGGAGGGAGAGGGAGGG - Intergenic
1074053229 10:109898937-109898959 TGGGAGAAGAGGGTCAGGGAAGG - Intronic
1074204672 10:111272313-111272335 AAGAGGAAGAGGGAAAGGGGAGG + Intergenic
1074942415 10:118248357-118248379 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
1074947275 10:118293428-118293450 GAGATGAAGAAGGAAAGGGAAGG - Intergenic
1075013627 10:118894914-118894936 GAGACGGAGAGGGAGAGGGAGGG - Intergenic
1075633821 10:124017191-124017213 TAGATGGACAGGGAGAGGCAGGG - Intronic
1075789938 10:125076863-125076885 AGGATGAAGAGGGTCTGGGAAGG - Intronic
1075993649 10:126859363-126859385 GAGATGAAGAGGAAGAGGGAAGG - Intergenic
1076163446 10:128263525-128263547 AAGAAGAAGAGGGACAGAGGAGG - Intergenic
1076691862 10:132227827-132227849 TAGATGAGGAGGGCTAGAGAGGG + Intronic
1076854507 10:133109254-133109276 GAGAGGAGGAGGGACAGGAAAGG - Intronic
1076867557 10:133175501-133175523 TAGATGAACAGGCACATGGATGG + Intronic
1077017666 11:404119-404141 AAGAAGAAGCGGGACAGGTAGGG + Exonic
1077378229 11:2215597-2215619 TAGGTGACGGGGGACCGGGACGG + Intergenic
1077378279 11:2215734-2215756 TAGGTGAGGGGGGACCGGGACGG + Intergenic
1077859041 11:6158779-6158801 TAGAAGAACAGGGCCAGGAAAGG + Intergenic
1077896619 11:6457914-6457936 TAGAAGGTGAGGGGCAGGGAGGG - Intronic
1079180955 11:18193083-18193105 TAGGTTTAAAGGGACAGGGAAGG + Intronic
1079270120 11:18976602-18976624 TAGACTGAAAGGGACAGGGAAGG - Intergenic
1079325433 11:19487082-19487104 TAGATAAAGAGGCCCAGTGAGGG - Intronic
1080411014 11:32024880-32024902 TAAATAAAGAAGGAGAGGGAAGG + Intronic
1080740856 11:35063184-35063206 GAGATGAAGTCAGACAGGGAAGG + Intergenic
1080868062 11:36213087-36213109 GAGTGGAAGAGGAACAGGGAGGG - Intronic
1080963641 11:37189151-37189173 GAGATGAAGAGGGAAAGGGAGGG - Intergenic
1081770780 11:45649583-45649605 AAGATGAGGTGGGAGAGGGAGGG + Exonic
1081781884 11:45718826-45718848 AAGAAGAAGAGAGACAGGGATGG - Intergenic
1082859481 11:57840825-57840847 GAGATGCAGAGGGAAAGGGAAGG - Intergenic
1082983497 11:59145233-59145255 GAGAGGAAGAGGGAGAGTGAAGG + Exonic
1082996576 11:59260628-59260650 TCCATGAAGAGGGGAAGGGAGGG - Intergenic
1083158670 11:60841366-60841388 TAGAAGAAGAGGGACGTGGGAGG + Intergenic
1083484936 11:62977280-62977302 TAGATGAAGAGAGGCATGGAGGG + Exonic
1083597248 11:63923887-63923909 AAAAGGAAGAGGGATAGGGAAGG - Intergenic
1083630128 11:64091064-64091086 AAGATGAGGAGGGACATGGGAGG + Intronic
1083779477 11:64910510-64910532 CAGGGGAAGAGGGACAGGGCTGG + Intronic
1083831852 11:65238583-65238605 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1084183536 11:67458368-67458390 TAGTTTGACAGGGACAGGGATGG + Exonic
1084270356 11:68026203-68026225 TCAATGTAGAGGGACAGGCAAGG + Intronic
1084920335 11:72464451-72464473 GAGAGGGAGAGGGAAAGGGAAGG - Intergenic
1085301276 11:75460217-75460239 TGGATGAGGAGGGCCAGGGAGGG - Intronic
1085792225 11:79506085-79506107 AAGGTGAAGGGGGATAGGGAGGG + Intergenic
1085950024 11:81319269-81319291 TAGATGGGGAGGAGCAGGGATGG - Intergenic
1086363042 11:86079021-86079043 TAGAGGAAGAAGGAAAGAGATGG - Intergenic
1087006642 11:93478278-93478300 AAGATGGAGAGGGACAGAAAGGG - Intergenic
1087624806 11:100584367-100584389 TAGTTGGTGAAGGACAGGGAAGG - Intergenic
1088334552 11:108689450-108689472 TAGATGAAGAGATGCAGGGAGGG - Intronic
1088544509 11:110946130-110946152 GAGATGGGGAGAGACAGGGAGGG - Intergenic
1088800759 11:113305208-113305230 GAGAAGAAGAGGGAAAGGAAAGG - Intergenic
1089270662 11:117299624-117299646 TAGGGGAAGAGGGGCAGGGAGGG - Intronic
1089393550 11:118118293-118118315 TGGGTGAAGACGGACAGGGCTGG - Exonic
1089553582 11:119301149-119301171 CAGGTGAAGAGGAAAAGGGAAGG - Exonic
1089585822 11:119508864-119508886 TAGAGGGAGAAGGAGAGGGAGGG + Intergenic
1090246027 11:125216537-125216559 TTGAAGAAGAGGGAAAGGGGTGG - Intronic
1090529459 11:127575825-127575847 TAGATGAAAATGCACAAGGATGG - Intergenic
1090684138 11:129096797-129096819 AAAATCAAGGGGGACAGGGAAGG - Intronic
1090821640 11:130347806-130347828 TTGGTCATGAGGGACAGGGATGG - Intergenic
1091601618 12:1921345-1921367 TAGATGATGAGAGGCAGGGTGGG - Intergenic
1092624694 12:10313997-10314019 AATGTGAAGAGGGCCAGGGATGG + Intergenic
1092624775 12:10315414-10315436 AATGTGAAGAGGGCCAGGGATGG - Intergenic
1093366975 12:18314473-18314495 TAGAAAGAGAGGGAGAGGGAGGG - Intronic
1094484341 12:30912351-30912373 TAGATCATGAGGGTCAGGGTAGG - Intergenic
1095224126 12:39658649-39658671 TAGAAAAAGAGGCAAAGGGATGG - Intronic
1095464705 12:42478104-42478126 GAGAGAAAGAGGGAGAGGGAGGG - Intronic
1095896756 12:47287602-47287624 TGGAAGAAGAGGAATAGGGAAGG - Intergenic
1096109657 12:49021263-49021285 CAGATCAAGAGGGAGGGGGATGG + Exonic
1097110255 12:56652481-56652503 GAGAGGGAGAGGGAGAGGGACGG + Intergenic
1097200309 12:57272641-57272663 GAGATGGGGAGGGAAAGGGAAGG + Intronic
1097784266 12:63741915-63741937 TAGGTTAAGGGGGATAGGGATGG - Intergenic
1098334115 12:69383939-69383961 TAAAAGAAGAGGTAGAGGGATGG + Intronic
1098412424 12:70201126-70201148 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1099413439 12:82359300-82359322 TAGCTGCAGAGCCACAGGGAGGG + Intronic
1099457132 12:82877602-82877624 AAGAAAAAGAGGGACAGGTAAGG - Intronic
1099658231 12:85522411-85522433 AAGAGGAAGAGAGAGAGGGAAGG + Intergenic
1100106329 12:91178128-91178150 AAAAGGAAGAGGGACAGAGAGGG + Intronic
1100540301 12:95551231-95551253 TTGATGAAGGTGGGCAGGGAAGG - Intronic
1101237000 12:102799701-102799723 TAGATGAAGAAGCAAAGGCACGG - Intergenic
1101510893 12:105391273-105391295 GAGAGGGAGAGGGAGAGGGAAGG + Intronic
1102012765 12:109628723-109628745 GAGAGGAAGAGAGAGAGGGAGGG - Intergenic
1102175180 12:110868713-110868735 GAGAGGGAGAGGGAGAGGGAGGG + Intronic
1102247864 12:111366610-111366632 TTGAGGAACATGGACAGGGAGGG - Intronic
1102558044 12:113741884-113741906 CAGAGGAAGAGAGAGAGGGAGGG + Intergenic
1102579096 12:113874690-113874712 GAGATGATGATGGATAGGGAAGG + Intronic
1102717124 12:114983961-114983983 TAAAGGAAGAGAGAAAGGGAGGG - Intergenic
1102907756 12:116690071-116690093 AAGATGAAGGAGGAGAGGGAGGG - Intergenic
1102992063 12:117322551-117322573 GAGGGGAGGAGGGACAGGGAAGG - Intronic
1103291545 12:119850427-119850449 AGGAAGAAGAGGGAAAGGGAAGG + Intronic
1103339926 12:120215844-120215866 GAAAGGAAGAAGGACAGGGAGGG + Intronic
1104165142 12:126221019-126221041 TCTTAGAAGAGGGACAGGGATGG - Intergenic
1104781559 12:131423754-131423776 AAGAGGAAGAGAGACAGGGCTGG + Intergenic
1104938147 12:132377966-132377988 GAGATGGAGAGGGAGAGAGACGG + Intergenic
1104938226 12:132378471-132378493 GAGATGGAGAGGGAGAGAGACGG + Intergenic
1105046334 12:133006964-133006986 AAGATGCAGAGGAACTGGGAAGG - Intronic
1105215995 13:18285712-18285734 TGCATGCAGAGAGACAGGGAGGG + Intergenic
1105354254 13:19644283-19644305 TAGATATAGAGGGAGAGAGAGGG - Intronic
1105636372 13:22219692-22219714 TAGATGATGAACGTCAGGGAAGG + Intergenic
1105857427 13:24385813-24385835 AAGAGGAAAAGGGACAAGGACGG + Intergenic
1106124603 13:26890019-26890041 ATGAGGAAGGGGGACAGGGAAGG + Intergenic
1106449275 13:29865043-29865065 GAAATGAAGAGTGACAAGGAAGG + Intergenic
1106450398 13:29876573-29876595 TAGGTGAAGAGTTATAGGGAGGG + Intergenic
1107841971 13:44467215-44467237 TATATGGTGAGAGACAGGGAGGG - Intronic
1107863701 13:44683422-44683444 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
1107863715 13:44683456-44683478 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
1107889417 13:44901284-44901306 TAGCTGGAGAGAGACAGGCAAGG + Intergenic
1108437781 13:50417587-50417609 GGAATGAAGAGGGACAGGCAAGG - Intronic
1108697852 13:52918543-52918565 TAGATGCAGGGGGAGATGGAAGG + Intergenic
1109333695 13:60964644-60964666 TAGATAAAGTGGGAGAGGGAAGG - Intergenic
1110935386 13:81281104-81281126 GAGAGGAAGAGAGAGAGGGAGGG + Intergenic
1110947531 13:81441952-81441974 TGGCTGAATAGGGCCAGGGATGG + Intergenic
1110951384 13:81496586-81496608 CAGATGAAAAGAGACAGAGAGGG + Intergenic
1111780687 13:92719907-92719929 AACAAGAAGAGGGAAAGGGAAGG - Intronic
1112417920 13:99219227-99219249 TAGCTGAAGACAGACAGGTAGGG - Intronic
1112479148 13:99757961-99757983 CTGATGAAGAAGGACTGGGATGG + Intronic
1112569778 13:100583510-100583532 TAAAGGAGGAGGGAAAGGGAAGG - Intronic
1112650979 13:101398253-101398275 TAGAGGAAGAGAGACTGGGAAGG + Intronic
1112725513 13:102299627-102299649 GAGGTGGAGAGGGAAAGGGATGG + Intronic
1112781620 13:102906932-102906954 TAGAGGAAGATGGATGGGGAAGG - Intergenic
1113265822 13:108617056-108617078 TAAATGAAGATGTTCAGGGATGG - Intronic
1113608178 13:111625038-111625060 GAAATGACGAGGGACAGGGAAGG - Intronic
1113658687 13:112088457-112088479 AAGATGAAAAGGGAAAGGAAGGG - Intergenic
1113677291 13:112215421-112215443 GAGCTGAAGGGGGGCAGGGAGGG + Intergenic
1113956513 13:114102403-114102425 GAGAGGGAGAGGGACAGAGAGGG + Intronic
1114031035 14:18581752-18581774 TAGAGGGAGTGGGCCAGGGAGGG + Intergenic
1114427487 14:22636400-22636422 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1114828894 14:26114266-26114288 GAGAGAAAGAGGGAAAGGGAGGG - Intergenic
1114859189 14:26494131-26494153 GAAATTTAGAGGGACAGGGAAGG - Intronic
1115795508 14:36930927-36930949 TAGATGAAGAAGCAGGGGGATGG - Intronic
1116201251 14:41799962-41799984 AAAAGGAAAAGGGACAGGGAAGG + Intronic
1116366732 14:44076336-44076358 TGGATAAATAGGGACAGGGATGG - Intergenic
1118184690 14:63526148-63526170 GACATGAAGAGGGCCAGGCATGG - Intronic
1118337307 14:64864821-64864843 AAGATGAAGAAGGAGAGGGAAGG + Intronic
1118775662 14:68972364-68972386 CAGGGGAAGAGGGACAAGGATGG + Intronic
1119108551 14:71947847-71947869 TATATGAAGATGAACAGTGACGG + Intronic
1119395392 14:74322598-74322620 CAGAAGCAGAGGGACAGGGTGGG - Intronic
1119757619 14:77130005-77130027 CAGGCAAAGAGGGACAGGGAGGG - Intronic
1119925399 14:78488826-78488848 GAAATGAAGAGGGAATGGGAGGG + Intronic
1120266750 14:82260543-82260565 TACAAGGAGAGGGAAAGGGAGGG - Intergenic
1120612648 14:86661376-86661398 TTGATGAAGAGACAGAGGGAAGG + Intergenic
1121335140 14:93073313-93073335 GAGGTGAAGAGGCACAGGGGTGG + Intronic
1121402016 14:93688350-93688372 TAGGTGAAGAGAGGCAGGAATGG + Intronic
1121678048 14:95770421-95770443 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1121697836 14:95927923-95927945 TGGAGGGAGAGGGAGAGGGATGG - Intergenic
1121697861 14:95927999-95928021 TGGAGGGAGAGGGAGAGGGATGG - Intergenic
1122387504 14:101359135-101359157 TGAATGAGGAGGGAAAGGGAAGG + Intergenic
1122708029 14:103633677-103633699 AAGATGAAAAGAGACAGGGTGGG - Intronic
1122794263 14:104198111-104198133 TGGATGGAGAGAGAAAGGGAGGG - Intergenic
1122967200 14:105136929-105136951 GAGCTGCAGAGGGAAAGGGAGGG - Intergenic
1123046839 14:105521627-105521649 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1123057967 14:105581288-105581310 TAGAGAGAGAGAGACAGGGATGG - Intergenic
1123439957 15:20283012-20283034 TTGATAAACAGGGAAAGGGAGGG - Intergenic
1124222327 15:27861510-27861532 AAGATGGAGAGGGTCATGGAAGG + Intronic
1124656785 15:31515637-31515659 TGGATGAAGAGAGAGAGGGAGGG - Intronic
1124712335 15:32024935-32024957 TAGATGAATAAGGATTGGGACGG + Intergenic
1124807606 15:32901698-32901720 TGGATGAAGAGGGAGAAGGAGGG - Intronic
1125102449 15:35930198-35930220 TAGCTGAGGAGGCAAAGGGATGG - Intergenic
1125268826 15:37915559-37915581 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
1125477717 15:40058672-40058694 TGGAGGAATTGGGACAGGGAAGG + Intergenic
1127296955 15:57617061-57617083 TAGATGCAGGGGGACAGAGTAGG - Intronic
1128570680 15:68730969-68730991 TACAGGAATAGTGACAGGGATGG + Intergenic
1128788177 15:70413485-70413507 TAGATGAAGCAGGAGAGGGAGGG - Intergenic
1128968333 15:72084248-72084270 AAGATGAAGAAGGACAAAGAAGG - Intronic
1129054328 15:72808086-72808108 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
1129160919 15:73747269-73747291 CAGATAGAGAGTGACAGGGATGG - Intronic
1129183249 15:73890153-73890175 TGGCTGAAGAGTGAGAGGGATGG - Intergenic
1130177385 15:81588611-81588633 GAGATGGAAGGGGACAGGGAGGG - Intergenic
1130233475 15:82113997-82114019 TAGATGAAGAGGGAAGGAGGAGG - Intergenic
1131259748 15:90882226-90882248 TTGCTTTAGAGGGACAGGGAAGG - Exonic
1131312570 15:91304268-91304290 GAGATGAAGAGAGAGAGGGAAGG + Intergenic
1131312576 15:91304338-91304360 GAGATGAAGAGAGAGAGGGAAGG + Intergenic
1131487518 15:92834016-92834038 TAGAAGGAGAGGGAGAGAGAGGG - Intergenic
1131488030 15:92838294-92838316 CAGATGAAGAATGACCGGGATGG + Intergenic
1132664745 16:1076256-1076278 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1132672258 16:1106685-1106707 CAGAGGAAGATGGCCAGGGAGGG - Intergenic
1133043614 16:3073978-3074000 TGGATGCACAGGGGCAGGGATGG + Intronic
1133365213 16:5203731-5203753 TGGAGGGAGAGGGAGAGGGAGGG + Intergenic
1133437092 16:5789079-5789101 GAGAGGAAGAGGGAGAGAGAGGG - Intergenic
1133485516 16:6215047-6215069 GAGAAGGAGAGGGAGAGGGACGG + Intronic
1133981582 16:10636554-10636576 GAGAAGAAGAGGGAGAGGAAGGG + Intronic
1134078888 16:11311309-11311331 GAGATGTGGAGGGGCAGGGAGGG + Intronic
1134216981 16:12323764-12323786 AAGAAGACGAGGCACAGGGAAGG - Intronic
1134316819 16:13126587-13126609 GAGAGAAAGAGAGACAGGGAGGG + Intronic
1135460199 16:22635678-22635700 TAGAGAAAAAGGGAGAGGGAAGG - Intergenic
1135646735 16:24169471-24169493 AAGAAGAAGGGGGACAGGGTAGG - Intronic
1135829075 16:25757668-25757690 AAGATGAAAAGGAAGAGGGATGG - Intronic
1135920197 16:26642683-26642705 TTGATGAAGAGGGACAGAAAGGG - Intergenic
1136101620 16:28000925-28000947 TAGAAGATGAGGAACAGGCAAGG - Intronic
1137518951 16:49175244-49175266 TAGTAGAAGAGGGAGAGGGAGGG - Intergenic
1137523199 16:49211220-49211242 GAGAGGGAGAGGGACGGGGAGGG + Intergenic
1137803856 16:51285682-51285704 GAGATAAAGTGGGGCAGGGAAGG + Intergenic
1137807282 16:51319351-51319373 TGGAAGAAGCAGGACAGGGAAGG - Intergenic
1137909960 16:52367592-52367614 TAGATAAAGTTGGTCAGGGAAGG - Intergenic
1137953243 16:52803569-52803591 GAGAAGAAGAGGAACAGGAAGGG + Intergenic
1139080800 16:63517965-63517987 TAGATGAAGAGAAACAGAAATGG - Intergenic
1139195395 16:64912700-64912722 AAGATAAAGAGGGACGGGGGTGG + Intergenic
1139521399 16:67484516-67484538 AAGATGAAGGGGGCCAGGTATGG + Intergenic
1140074481 16:71684726-71684748 CAGATGGAGGGGGACAAGGAGGG - Intronic
1140240051 16:73192234-73192256 CAGACGCAGAGGGGCAGGGAGGG - Intergenic
1140262408 16:73391680-73391702 TACAGGATGATGGACAGGGAGGG + Intergenic
1140543762 16:75786022-75786044 TAGATGAAGGGAGGAAGGGAAGG - Intergenic
1140697258 16:77547427-77547449 TGGATGGAGGGAGACAGGGAGGG + Intergenic
1141366753 16:83450578-83450600 TTGATAAAGAGGGCCAGGGGCGG + Intronic
1141571721 16:84938194-84938216 TAGATTCAGGAGGACAGGGATGG - Intergenic
1141883738 16:86877888-86877910 CAGAGAGAGAGGGACAGGGAGGG - Intergenic
1141927496 16:87178972-87178994 GGGAGGAAGAGGGAGAGGGACGG - Intronic
1142614803 17:1127983-1128005 GAGATTCAGAGGGAAAGGGAGGG - Intronic
1142674330 17:1504312-1504334 GAGATGAGGAGGGGCCGGGAAGG + Intronic
1143091273 17:4450327-4450349 GAGAGGGAGAGGGAGAGGGAGGG - Intronic
1143247768 17:5500661-5500683 TAGATGAAGATGGAGAGGTGCGG + Intronic
1143421016 17:6792363-6792385 TACAGGGTGAGGGACAGGGAGGG - Intronic
1143545669 17:7593694-7593716 TAGATATAGAGGGACAGTCAGGG - Intronic
1143664049 17:8346071-8346093 TAGAGGAGGAGGGAGAGGAAGGG + Intergenic
1143687983 17:8534562-8534584 TAGAGGTAGAGGGAAAGGAATGG - Intronic
1143876803 17:9997874-9997896 GAGATGCACAGGGCCAGGGATGG + Intronic
1144051916 17:11504168-11504190 TATATGAGGAGGAAGAGGGAAGG + Intronic
1144065589 17:11621432-11621454 AAGAGCCAGAGGGACAGGGAAGG + Intronic
1144251040 17:13416930-13416952 TAGATAAACAGGTACATGGATGG + Intergenic
1145226092 17:21129254-21129276 GAAATGAGGAGAGACAGGGAAGG + Intronic
1145245528 17:21266742-21266764 GAGAGGCAGAGAGACAGGGAGGG + Intergenic
1145984696 17:29037661-29037683 TAGATTAAGAGGGGCTAGGATGG + Intronic
1146426478 17:32744337-32744359 CAGATGAGGAGGGGCTGGGAAGG - Intronic
1146890323 17:36502418-36502440 TAGATGTAGAGGGAGAGGAAAGG - Intronic
1147054656 17:37825013-37825035 TGGAGGAAGAGGGAGAGGGGTGG + Intergenic
1147167911 17:38603175-38603197 AAGAGGGAGAGAGACAGGGAAGG + Intronic
1147303897 17:39550193-39550215 TATCTGAATAGGGACAGGGGAGG + Intronic
1147722320 17:42546864-42546886 TAGATAGGTAGGGACAGGGAGGG + Intergenic
1147723505 17:42553034-42553056 TAGATAGGCAGGGACAGGGAGGG + Intronic
1148202231 17:45756788-45756810 TGGAAGCAGAGGGACAGGGATGG + Intergenic
1148454244 17:47802364-47802386 AAGATGAAGATGGGCAGGCAGGG + Intergenic
1148873960 17:50675651-50675673 CAGATGGGGAGGGACAGGGTCGG + Exonic
1149632841 17:58141783-58141805 GAGAGGAAGAGGGAGGGGGAGGG - Intergenic
1149702249 17:58664957-58664979 TAGATGAAGAAGGGCAGGGCAGG + Intronic
1149965261 17:61156324-61156346 AAAATGAAGAGGGAAAGAGAAGG - Intronic
1150213738 17:63455820-63455842 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1151190175 17:72392623-72392645 GAGATGGAGAGGGAAAGGAAAGG - Intergenic
1151630815 17:75309640-75309662 TAGGGGAAGAGGGGCAGGGTGGG - Intergenic
1151787640 17:76282998-76283020 CAGATGCAGAGGGACAGGTGGGG + Intronic
1151871711 17:76841248-76841270 GAGATGCAGAGAGAGAGGGAGGG - Intergenic
1151979006 17:77498191-77498213 TAGACTCAGAGGGACAGGGCTGG - Intronic
1152134355 17:78495153-78495175 TAGGTGAAGAGGGACAGGCAGGG - Intronic
1152644408 17:81462120-81462142 AAGATGAAAAAGGAGAGGGAAGG - Intronic
1152771525 17:82172585-82172607 GAGAGGAAGGGGGAGAGGGAGGG - Intronic
1152885016 17:82844638-82844660 TAGAAGAGGAAGGGCAGGGAAGG - Intronic
1153007838 18:513074-513096 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
1153364988 18:4246040-4246062 AAGATGAAGACGTATAGGGAAGG - Intronic
1153828155 18:8896279-8896301 GAGAGAAAGAGAGACAGGGAGGG + Intergenic
1154037736 18:10821725-10821747 TAAATGGTGAGAGACAGGGAGGG - Intronic
1154962836 18:21327435-21327457 GAGATGAGGAGGGACTGGCAAGG - Intronic
1155424042 18:25687471-25687493 TAGAAAAAGAGGGCCAGGCATGG + Intergenic
1156278318 18:35606690-35606712 AAAAGGAAGAGGGACAGTGATGG - Intronic
1156379519 18:36545102-36545124 GAGATAAAGAAGGAGAGGGAGGG - Intronic
1156394926 18:36690906-36690928 TAGAAGCAGAGGTAGAGGGATGG - Intronic
1156473665 18:37392842-37392864 CAGATGACGGGGGAAAGGGAAGG - Intronic
1156552212 18:38029506-38029528 TAGGTGAACACGGACAGTGAAGG + Intergenic
1156779706 18:40836853-40836875 TAGAGAAAGAGGGAGAGGGAGGG + Intergenic
1157490037 18:48116710-48116732 TAGATGAGGAATGACAGAGAGGG - Intronic
1157588205 18:48818647-48818669 TAGATGGAGAGGGAGAGGAAGGG + Intronic
1157686893 18:49650143-49650165 TAGGGGAAGAGGGAAGGGGAAGG + Intergenic
1157793785 18:50557393-50557415 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
1157959798 18:52140627-52140649 GAGATAAAGAGGCACAGAGAGGG + Intergenic
1157993986 18:52532961-52532983 TAGTAGAAGAGGGACTGGGGTGG - Intronic
1158582094 18:58692460-58692482 GAGAGGAAGAGGGACAGGGAGGG - Intronic
1159360036 18:67388386-67388408 AAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1159672216 18:71235756-71235778 AAAATGAAGAGGAAGAGGGAAGG + Intergenic
1160144712 18:76354036-76354058 TAGATGAAAACTGACAGAGAAGG - Intergenic
1160376807 18:78420004-78420026 TGCATGAGGAGGGCCAGGGAAGG - Intergenic
1160501951 18:79406011-79406033 TAGATGAAACGGGGCAGGAAAGG - Intronic
1161620360 19:5293926-5293948 GAGAGGAGGAGGGAGAGGGAGGG + Intronic
1162075978 19:8187652-8187674 AAGAGGAAGAGAGAAAGGGAGGG + Intronic
1162320190 19:9967076-9967098 GAGATGGACAGAGACAGGGAGGG + Intronic
1162959294 19:14116978-14117000 AAGGTGAAGAGGGAAAGGGCAGG + Intronic
1162997770 19:14347202-14347224 GAGATAAGGAGGGACAGGAAGGG + Intergenic
1163016819 19:14461374-14461396 TAGATAGAGAGGGGCATGGACGG - Intronic
1163123904 19:15233696-15233718 AAGAGGAAGTGGGACAGGGCCGG + Intergenic
1163150382 19:15409326-15409348 TTGATGAAAAGGGAGAGGCAGGG + Intronic
1163276408 19:16287256-16287278 GAGATAAAGAGAGACAGAGAGGG - Intergenic
1163464691 19:17460524-17460546 GAGGTGAGGAGGGGCAGGGAGGG - Exonic
1163572197 19:18089080-18089102 TGGACGAAGATGGACAGGAAAGG + Intronic
1163912940 19:20213863-20213885 GAGACGGAGAGGGAGAGGGAGGG - Intergenic
1164030659 19:21400733-21400755 AAGATAAAAGGGGACAGGGAGGG + Intronic
1164424157 19:28125410-28125432 GAGATGGAGAGTGACAGGAAGGG + Intergenic
1164441127 19:28281732-28281754 TGAAAGAAGAGGGTCAGGGAAGG - Intergenic
1164802035 19:31084971-31084993 TGGGTGAAGAGTGCCAGGGAAGG - Intergenic
1164828844 19:31304423-31304445 AAGATGCAGAGGGAGAGGCAGGG - Intronic
1165399541 19:35589205-35589227 GATCTGGAGAGGGACAGGGATGG - Intergenic
1165421559 19:35724580-35724602 TAGAAGAAGAGGGGCGTGGAAGG + Intronic
1166098442 19:40556064-40556086 TCGCTGAAGGGGGACATGGAGGG - Exonic
1166311749 19:41967003-41967025 GAGATGGAGAGAGACAGGCAAGG + Intronic
1166396811 19:42447203-42447225 TAGATCAATTGGGACAGGGCAGG + Intergenic
1166580678 19:43895849-43895871 GAGAGGGAGAGGGAGAGGGAAGG + Intronic
1166732992 19:45069122-45069144 CAGGTGAAGTGGGAAAGGGAGGG + Exonic
1167078104 19:47261161-47261183 GAGACAGAGAGGGACAGGGAGGG - Intronic
1167104596 19:47422627-47422649 GAGATGAAGAGACACAGAGAGGG - Intergenic
1167120889 19:47515683-47515705 TAGCTGAAGAGGGCCGGGCACGG + Intergenic
1167459161 19:49615313-49615335 GAGAAAAAGAGGGACAGAGATGG + Intronic
1167676180 19:50887610-50887632 CAGAGGGAGAGAGACAGGGAAGG - Intergenic
1167793200 19:51693018-51693040 GAGATGGAGACAGACAGGGAAGG - Intergenic
1167818195 19:51903061-51903083 CAGATGAAGAGGCAGATGGAAGG + Intronic
1167924336 19:52810897-52810919 TGGAGGGAGAGGGAGAGGGAGGG - Intronic
1167937210 19:52918974-52918996 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1167971235 19:53188582-53188604 GAGAGGGAGAGGGAGAGGGAGGG + Intronic
1168063186 19:53905653-53905675 GAGATGAAGGGGAAGAGGGAGGG - Intronic
1168301647 19:55408039-55408061 GAGAGGAAGGGGGACGGGGAAGG + Intergenic
925009763 2:474384-474406 AAGATGAAGAGAGAGAGGGACGG + Intergenic
925097608 2:1219727-1219749 GAGAGGAAGAGGGAAAGGGAGGG + Intronic
925176547 2:1788543-1788565 GACAGGAACAGGGACAGGGACGG + Intergenic
925188742 2:1866617-1866639 GAGAGGCAGAGGGAGAGGGAGGG + Intronic
925191673 2:1889730-1889752 TAGATAAATAGGGAAATGGAGGG - Intronic
925285575 2:2713575-2713597 TAGAGGAACAGGGAATGGGAGGG + Intergenic
925771685 2:7288523-7288545 AAGATGAAGAGAATCAGGGAAGG + Intergenic
925976837 2:9147811-9147833 TAGAGGACCAGGGACAGGGTAGG - Intergenic
926358156 2:12060144-12060166 TACATAAAGAAGGACAGAGAAGG + Intergenic
926726880 2:16005322-16005344 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
927813167 2:26191654-26191676 TAGAAGAAGAGGAAAAGGGGAGG + Intronic
928005623 2:27558901-27558923 GAGAGGGAGAGGGAGAGGGAGGG + Intronic
928292524 2:30052151-30052173 TAGTTGAACAGGAACAGGTAAGG - Intergenic
928966226 2:36978148-36978170 GAGAGGAAGGGAGACAGGGAGGG + Intronic
929583167 2:43097277-43097299 TAGGTGAAGTGGGAGAGAGAGGG + Intergenic
930363463 2:50411044-50411066 GAGAGGGAGAGGGACGGGGAGGG - Intronic
930565060 2:53008505-53008527 TAGATGAATATGGCCAGGCACGG + Intergenic
930622550 2:53658996-53659018 GAGAAGAAGAGGGGAAGGGAGGG + Intronic
931121605 2:59226309-59226331 TAAAACAAGAGTGACAGGGAAGG + Intergenic
931121772 2:59227675-59227697 TACATGAAGAGTGATAGTGATGG - Intergenic
931201704 2:60103933-60103955 TAGATGAAGAAGGCCAGGGAGGG - Intergenic
931905362 2:66836741-66836763 GGGAAGAAGAGGGACAGGAAGGG + Intergenic
931921118 2:67016799-67016821 AAAGTGAAGAGGGACAGAGAGGG - Intergenic
932440070 2:71729140-71729162 TAGATGAATGGGGAGAGGGGTGG - Intergenic
932569011 2:72927893-72927915 TAGAAGGAGAGGGACAGGGAGGG - Intronic
932851620 2:75193096-75193118 GAGAAGAAGAAGGAGAGGGAGGG - Intronic
932973134 2:76570186-76570208 GTGAGGAAGAGGGACAGGGAAGG + Intergenic
934298333 2:91761014-91761036 TGCATGCAGAGAGACAGGGAGGG - Intergenic
936088194 2:109483950-109483972 TAGAGGTGGAGGCACAGGGATGG - Intronic
937202109 2:120210309-120210331 TACAGGCAGAGGGACTGGGAGGG + Intergenic
938497170 2:131804022-131804044 TAGAGGGAGTGGGCCAGGGAGGG - Intergenic
938624258 2:133091311-133091333 TAGCTGGAGAGGGACAGGAAAGG - Intronic
938852563 2:135275925-135275947 TAAAAGAAGAGGGACAAGAAGGG + Intronic
939188317 2:138886243-138886265 TAGATGGAGAGAGAGAGAGAGGG - Intergenic
939308516 2:140440721-140440743 TACATACAGAGGGACAAGGATGG - Intronic
939430589 2:142100912-142100934 AAGATGAAGGGAGAGAGGGAAGG + Intronic
939474422 2:142668462-142668484 AAGATGAAGAGGGAAAAGGGGGG - Intergenic
939694769 2:145311028-145311050 AGGATGCAGAGGAACAGGGAAGG - Intergenic
939794344 2:146622990-146623012 CAGATGAAGTAGGAAAGGGAAGG - Intergenic
939853668 2:147330929-147330951 AAGATGAAGAGGGGAGGGGAGGG + Intergenic
940054681 2:149501011-149501033 ATGATGAAGAAGGACAGGGTAGG - Intergenic
940061512 2:149575393-149575415 GAGATGGAGAAGGAGAGGGAGGG + Intronic
940608038 2:155952939-155952961 GAGAGGAAGTGGGACAGGAAGGG + Intergenic
941442606 2:165556544-165556566 TGGATGAAGAGGGACCTGCATGG + Intronic
941655451 2:168139061-168139083 TAGATGAAGCGTGAAAGTGACGG + Intronic
941997751 2:171616778-171616800 TAGAAGAAGGGGAACAGGCATGG - Intergenic
942260564 2:174157345-174157367 AAGATGAAGGGGAACAGGGAAGG + Intronic
942667628 2:178337030-178337052 GAGATGAAGAGGCTCAGAGATGG - Intronic
942824690 2:180161064-180161086 GAGAGGAAGAGAGAGAGGGAAGG + Intergenic
943096805 2:183438945-183438967 TAGATCAAGAGGATCAGAGATGG - Intergenic
943619262 2:190129858-190129880 CAGAGGAAGAAGGACAGAGAAGG - Intronic
943914476 2:193611443-193611465 GAGATGAAGATGAACAGGCAAGG - Intergenic
944139427 2:196438932-196438954 GAGATGAAGTGGGGAAGGGATGG + Intronic
944655713 2:201874876-201874898 TACAGGAAGAGGAACAGGGCAGG - Intronic
945232770 2:207609793-207609815 GAGAGGGAGAGGGAGAGGGAGGG - Exonic
946019088 2:216627482-216627504 TAGATGGAGAGGGACAGAGGGGG - Intergenic
946346938 2:219118476-219118498 TGGAGGGGGAGGGACAGGGAGGG + Intronic
946361267 2:219220526-219220548 TAGAGGTAAAGGGACAGGAAAGG + Intronic
946853340 2:223929047-223929069 CAGATGCAGAAGGACAGTGAAGG + Intronic
948706312 2:239795602-239795624 TAGGGGAAGAGGGATGGGGAGGG - Intronic
1168774093 20:433942-433964 GAGATGAACAGGGTTAGGGATGG + Intergenic
1169673513 20:8130822-8130844 TAGGTAGAGATGGACAGGGAAGG - Intergenic
1170371059 20:15648685-15648707 TAGATGAACAGGTAGATGGATGG + Intronic
1170399087 20:15960565-15960587 GTGAGGAAGTGGGACAGGGAAGG + Intronic
1170533422 20:17316480-17316502 TAGAGAAAGGGAGACAGGGAAGG - Intronic
1170950268 20:20930453-20930475 TGGAGGAAGCGGGACAGGGAAGG - Intergenic
1170988540 20:21280882-21280904 TAGAAGCAGAGGGAGAAGGAAGG + Intergenic
1171049296 20:21840422-21840444 AAGGGGAAGAGAGACAGGGAAGG - Intergenic
1171180690 20:23088510-23088532 TGAATGAAGGGGCACAGGGAGGG - Intergenic
1171888317 20:30678941-30678963 TAGATGAACAGAGACTGAGAAGG + Intergenic
1171905838 20:30899314-30899336 TAGAAGGAGAGGGAGAGGGAAGG - Intergenic
1172024384 20:31938086-31938108 GAGAGGGAGAGGGAGAGGGAGGG - Intronic
1172561187 20:35890017-35890039 TAAATAAATAGGGCCAGGGATGG - Intronic
1172567929 20:35945559-35945581 TTGATGAAGAGGTACTGGGTGGG + Intronic
1173237413 20:41259630-41259652 AAGATGAAGGGAGAGAGGGATGG + Intronic
1173898782 20:46571739-46571761 GAGAGGAAGAGGGACTGGGGTGG + Intronic
1174139337 20:48401810-48401832 TAGAGCATGGGGGACAGGGAAGG + Intergenic
1174291677 20:49513346-49513368 AAGATGAAGAGGCTCAGAGAGGG + Intronic
1174401102 20:50276443-50276465 TGGCTGACGGGGGACAGGGATGG + Intergenic
1174783707 20:53413069-53413091 GAGCGGAAGAGGGACAGGGAGGG + Intronic
1175531258 20:59675193-59675215 AAGAGGGAGAAGGACAGGGAGGG - Intronic
1176880781 21:14190608-14190630 TAGATGAAGAGAAATAAGGAAGG + Intronic
1177953972 21:27573898-27573920 TAGAGGAAGAGGTAGAGGTAGGG + Intergenic
1178305911 21:31489810-31489832 CAGATGAAGTGGGATGGGGAGGG - Intronic
1178974710 21:37210884-37210906 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
1179396214 21:41042781-41042803 GAGATGAAGAAGGAGAGAGAGGG - Intergenic
1179466910 21:41581884-41581906 GAGATGGAGAGAGACAGAGAGGG - Intergenic
1179479934 21:41670544-41670566 GAGGTGGAGGGGGACAGGGAAGG + Intergenic
1179567475 21:42258274-42258296 TAGATGGAGAGATAAAGGGAGGG - Intronic
1179716892 21:43293051-43293073 TGGAGGAGGGGGGACAGGGAGGG - Intergenic
1179716927 21:43293151-43293173 TGGAGGAGGGGGGACAGGGAGGG - Intergenic
1180339256 22:11605419-11605441 TAGAAGGAGGGGGAGAGGGAAGG - Intergenic
1180455148 22:15508810-15508832 TAGAGGGAGTGGGCCAGGGAGGG + Intergenic
1180787207 22:18553732-18553754 CAGATGAAGTGGCACAGGGCTGG - Intergenic
1180924728 22:19545589-19545611 TAGATTAAATGGGACTGGGAGGG - Intergenic
1181234533 22:21441574-21441596 CAGATGAAGTGGCACAGGGCTGG + Intronic
1181244115 22:21493257-21493279 CAGATGAAGTGGCACAGGGCTGG - Intergenic
1181426807 22:22849064-22849086 TGGAAGGAGAGGGAGAGGGAGGG - Intronic
1181437388 22:22918654-22918676 GAAATGAAGGGGGACAAGGATGG + Intergenic
1181477175 22:23175946-23175968 TAGAGGCAGAGGGACTGAGAAGG - Intergenic
1181585933 22:23853810-23853832 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1182106819 22:27695561-27695583 GAGAGGGAGAGGGAGAGGGAAGG + Intergenic
1182478879 22:30593503-30593525 AAGAAGAAGAAGGAAAGGGATGG + Intronic
1182651025 22:31851428-31851450 GAGGTGGAGAGGGGCAGGGAAGG - Intronic
1182740563 22:32564280-32564302 CAGATGAAGAGGCCCCGGGAGGG + Intronic
1183693596 22:39405761-39405783 TCGATGGAGATGGAAAGGGACGG + Intronic
1184860569 22:47171290-47171312 CAGGTGACAAGGGACAGGGAGGG - Intronic
1184988225 22:48150353-48150375 TTGGTGAAGTGGGAAAGGGAAGG + Intergenic
1185081678 22:48712855-48712877 TGGAGGAGGAGGGACAGGCAGGG + Intronic
1185396172 22:50590664-50590686 AAGAGGAAGAGGAAGAGGGAGGG - Intronic
949227210 3:1709441-1709463 TAGATAACGAGATACAGGGAGGG + Intergenic
949581403 3:5392032-5392054 AAAATTAAGAGGGAAAGGGAGGG + Intergenic
949707351 3:6834378-6834400 GAGAAGAAGAGGGAGAGGGAGGG + Intronic
950110648 3:10416699-10416721 TGGAGGAAGAGGTACAAGGAGGG + Intronic
951439132 3:22702563-22702585 TGGCTGAAGAGAGAAAGGGAAGG + Intergenic
951793697 3:26515435-26515457 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
951945601 3:28132320-28132342 TATATAAAGAGGGCCAGGTACGG - Intergenic
953281500 3:41562617-41562639 AAGATGAAAAGAGACAGAGAAGG - Intronic
953425806 3:42796880-42796902 GAGAGGGAGAGGGAGAGGGACGG - Intronic
954243896 3:49315820-49315842 TAGATTAAGGAGGGCAGGGATGG - Intronic
954916361 3:54151388-54151410 TGGATGAATAGGTAGAGGGATGG + Intronic
955116419 3:56009436-56009458 TAGATGAAGAAGGAAAAGAATGG - Intronic
955693267 3:61610777-61610799 GAGATGGAGAGAGAGAGGGAGGG - Intronic
956143517 3:66169485-66169507 TAGATGGGGTGGGACAAGGAAGG - Intronic
956864188 3:73353138-73353160 TAAATGAAGGGGGAAAGGAAGGG + Intergenic
956877708 3:73479890-73479912 TAGATGATGAGGGGAAGGAAAGG + Intronic
957061043 3:75481588-75481610 TAGAAGAAGAGGGAGAGAAAAGG - Intergenic
957163558 3:76641490-76641512 TAGATCATGAAGGACAAGGAAGG + Intronic
957722165 3:84016578-84016600 GAGATAGAGAGAGACAGGGAGGG + Intergenic
958679750 3:97313067-97313089 TAGCTGAGGGGAGACAGGGAAGG - Intronic
959153675 3:102639791-102639813 TAAATGAAGTGGGCCAAGGAAGG + Intergenic
959334915 3:105052047-105052069 TAGAAAAAGAGAGAGAGGGAGGG + Intergenic
960344732 3:116518639-116518661 CAGAGGGAGAGGGAGAGGGAGGG - Intronic
960566029 3:119132456-119132478 AAGATGAAAAGGGACAAAGAAGG + Intronic
960924693 3:122782802-122782824 AAAAGGAAGAGGGATAGGGAAGG + Intronic
961141698 3:124561807-124561829 TAGAGGCAGAGTGACAGGTAGGG - Intronic
961697249 3:128713965-128713987 GGGACCAAGAGGGACAGGGAGGG + Intergenic
961943304 3:130658902-130658924 AAGATGAAGTGTGACAGGGTGGG - Intronic
962102393 3:132356457-132356479 TAGATGAACAGGGACATAGGAGG - Intronic
962186828 3:133269232-133269254 TAGAGAAAGAGGGGGAGGGAGGG + Intronic
962193009 3:133330987-133331009 TAGGAGAGGAGGGACGGGGATGG + Intronic
962693621 3:137926317-137926339 TAGATGAAGAGAGGAAGGAAGGG - Intergenic
963017923 3:140843360-140843382 TAGAGGAAGAAAGACAGGGCAGG + Intergenic
963025698 3:140916800-140916822 AAAGTGAAGAGGGAAAGGGAGGG - Intergenic
963035890 3:141028508-141028530 TCTATGGAGTGGGACAGGGAGGG - Intergenic
963851581 3:150215607-150215629 TAGATGAGGAGGGAACGGAAAGG + Intergenic
964503851 3:157377146-157377168 TAGAAGAAGATTGACAGCGAGGG + Intronic
965196093 3:165597001-165597023 GAGATGAAGAGGAACATAGAGGG - Intergenic
965355061 3:167663692-167663714 TAATTTAAGAAGGACAGGGAAGG + Intergenic
965594876 3:170400715-170400737 TAGAAAGAGAGGGAGAGGGAGGG - Intergenic
966318592 3:178676381-178676403 CAGATGGAGAGGGACAGTGCAGG + Intronic
966939881 3:184739166-184739188 GACCAGAAGAGGGACAGGGAAGG + Intergenic
967191298 3:186987166-186987188 AAGAGAAAGAGAGACAGGGAGGG + Intronic
967951084 3:194841243-194841265 GAGATGGAGAGAGACAGTGAGGG - Intergenic
969331607 4:6476455-6476477 GAGAGGGAGAGGGACAGAGAGGG - Intronic
969334372 4:6498954-6498976 CAGAGGGAGAGGGAGAGGGACGG - Intronic
969420071 4:7088886-7088908 TAGAAGAACAGGGCCAGGAAAGG + Intergenic
970509575 4:16767971-16767993 TTGGTGAAGAGGGATAGGGTTGG - Intronic
970919791 4:21380423-21380445 GGGATGATGAGGGAGAGGGAGGG + Intronic
971259405 4:25042785-25042807 AAGATGGAGAGAGACAAGGAAGG + Intergenic
971383440 4:26120996-26121018 AAGAGGAAGAGGGAGAGGGAGGG + Intergenic
973105008 4:46324711-46324733 TTGATGGAGAGGGAGGGGGAGGG - Intronic
973286082 4:48418148-48418170 AAGAAGAAGAGGGAGAAGGAAGG - Intronic
973605333 4:52581520-52581542 TAGATGAATAGGGGCAGAGAAGG + Intergenic
973752168 4:54032273-54032295 TAGAGGGAGAGGGAGGGGGAGGG - Intronic
974560314 4:63508339-63508361 TAGATCAAAACAGACAGGGAAGG + Intergenic
974767821 4:66370925-66370947 TAAAAGAAGAGGGGCAAGGAAGG - Intergenic
975407983 4:74014009-74014031 GAGAAGGAGAGGGAGAGGGATGG + Intergenic
975640815 4:76498342-76498364 TAGATTAACAGAGAGAGGGAGGG + Intronic
975658249 4:76662903-76662925 TAGAGGGAGAGGGAGAGGAAGGG + Intronic
975979969 4:80146067-80146089 GAGAGGAAAAGGGACAGAGAAGG - Intergenic
976086123 4:81408920-81408942 TAGAGGAAGAAGGACTGGCAAGG - Intergenic
976258118 4:83119764-83119786 AAGAAGAAGAAGGAAAGGGAAGG - Intronic
977400034 4:96521113-96521135 GAGGTGTAGAGGGACAGGCATGG + Intergenic
977481756 4:97587202-97587224 TAGAGGAAGAGGGAAAATGATGG - Intronic
978185356 4:105850768-105850790 TAGTTGAAGAAAGAAAGGGAAGG + Intronic
979356851 4:119715104-119715126 TAGAAGAAGTGGGTCAGGCATGG + Intergenic
979687430 4:123526225-123526247 TAGAACAAGAGGGAAAAGGAAGG - Intergenic
981588221 4:146327803-146327825 TAGATGCAGTGGCACAGGGGTGG - Intronic
981990725 4:150917416-150917438 TAGAGAAAGATGGACAGGAATGG + Intronic
982452560 4:155570418-155570440 TAGATGCACAGGGACTGAGAGGG - Intergenic
982717996 4:158829055-158829077 TAGGTTAAGAGAGACAGGCAAGG - Intronic
983396321 4:167201085-167201107 TAGAAAAACAGGGACAGAGATGG + Intronic
983435314 4:167707732-167707754 AAGATGAAGAGAGAAAGGAAAGG + Intergenic
983941089 4:173534762-173534784 GAGAAGAAGAGAGAGAGGGAGGG - Intergenic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
985080201 4:186256961-186256983 GAGAGGAAGAGGGAGAGAGACGG - Intronic
985609815 5:881154-881176 TATCTGAAGAGGAACGGGGACGG - Exonic
986248940 5:6037961-6037983 TAAATGAAGGGGAACAGGCAGGG + Intergenic
986591850 5:9378993-9379015 TAGATGAAAAAGGATGGGGATGG + Intronic
987049312 5:14136097-14136119 TTGATGAAGGGAGGCAGGGATGG + Intergenic
987749303 5:22019143-22019165 TAGATGGAGAGAGAAAGGGAGGG - Intronic
987818421 5:22932503-22932525 TAGATGAGGAGGTAGAGGGAAGG - Intergenic
987901299 5:24015426-24015448 TACATGAAGAGGAGAAGGGAGGG + Intronic
988468448 5:31513533-31513555 TAGTTGATGTGGTACAGGGAAGG - Intronic
988954066 5:36296102-36296124 CAGATGAAGAGGTACATGGGAGG - Intronic
989021688 5:37014240-37014262 GAGAAGGAGAGGGAGAGGGAGGG + Intronic
989389408 5:40884845-40884867 AAGAAGAAGAGGGCCAGGCATGG - Intergenic
989676838 5:43982632-43982654 TGGATGATGAGGGACTTGGAAGG - Intergenic
990159671 5:52923871-52923893 TCCATGAAGAAGGACAGAGATGG - Intronic
990273797 5:54174106-54174128 GAGATGAAGGGGGACAGACATGG - Intronic
990297916 5:54421354-54421376 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
990501259 5:56398643-56398665 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
990625259 5:57603530-57603552 AAGATAAAGAGAGACAGAGAAGG - Intergenic
990780335 5:59353739-59353761 GAAAAGAAGAGGGAGAGGGAAGG - Intronic
991173749 5:63660244-63660266 GAGAGAAAGAGGGAGAGGGAAGG - Intergenic
991309545 5:65221365-65221387 TATATTAACAGGGAAAGGGAGGG + Intronic
991488886 5:67164862-67164884 GAGTTCAAGAGGGACAGGAAAGG + Exonic
992013326 5:72552424-72552446 TAAAAGAACAAGGACAGGGAAGG + Intergenic
992290953 5:75279482-75279504 TGGATGAAGAGGGAAAAGGCAGG - Intergenic
992516923 5:77503259-77503281 AAGATCAAGAGAGACAAGGAAGG + Intronic
992743099 5:79793621-79793643 TTGATGAAGAGGGGAGGGGAAGG - Intronic
994098036 5:95864987-95865009 TAGATGAAGAAGGGCAGCTATGG + Intergenic
994330972 5:98506002-98506024 TAAAAGAAGAGGCACAGAGACGG + Intergenic
994735213 5:103545452-103545474 AAGATGGAGAGGGAAAGAGAGGG + Intergenic
994757002 5:103806060-103806082 TAGCTGAAGAGGAACAGAGCTGG - Intergenic
995053419 5:107732284-107732306 AAAATGAAGAGGGGCAGGGAAGG - Intergenic
995172057 5:109126218-109126240 TAGATGAACAGGTGCAAGGAAGG - Intronic
995470262 5:112494430-112494452 CAGATGACTTGGGACAGGGAAGG - Intergenic
997045481 5:130311834-130311856 TAGATGAAGAGAGACATAGACGG - Intergenic
997612857 5:135227378-135227400 CAGCTGAAGAGGGACAAGGCTGG - Intronic
997674814 5:135705038-135705060 AAGATGACCTGGGACAGGGAGGG + Intergenic
997854060 5:137357511-137357533 TGGAAGGAGAGGGTCAGGGAAGG + Intronic
997935757 5:138109218-138109240 TACATGAAGAGAAAAAGGGAGGG + Intergenic
998035613 5:138912834-138912856 TAGAAAAACAGGGACAGGAATGG - Intronic
999291323 5:150428268-150428290 GAGAGGAAAAGGGAGAGGGAGGG + Intergenic
999355241 5:150922847-150922869 GAGGTGAAGAGGGCCAGGCATGG + Intergenic
999442279 5:151611719-151611741 TAGATGAGGAGGTCCAGGAAAGG + Intergenic
999536148 5:152519421-152519443 TAGATGAGGATGGAGAGGCAAGG + Intergenic
999739881 5:154542085-154542107 TAGCTGAGGAGTGACAGAGAAGG + Intergenic
1000059188 5:157638061-157638083 TAGATGGAGAGGGCCAGGTGAGG - Intronic
1000194280 5:158942900-158942922 TAGTAGAAGAGGGAGGGGGAAGG + Intronic
1000194291 5:158942949-158942971 TAGTAGAAGAGGGAGGGGGAAGG + Intronic
1000363830 5:160472803-160472825 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1000394449 5:160758788-160758810 TAGAGAAAGAGAGACAGGGCAGG + Intronic
1000814284 5:165900785-165900807 TATATGAACAGGGACAGGTTTGG - Intergenic
1000815077 5:165910958-165910980 TAGGAGAAGGGGGACAGGAAAGG + Intergenic
1001055353 5:168445023-168445045 AAGAAGAAGAGGGCCAGGCACGG + Intronic
1001303768 5:170556569-170556591 CAGAGGAACAAGGACAGGGATGG + Intronic
1002868668 6:1146644-1146666 GAGATGCAGAGAGACAGAGAGGG + Intergenic
1003428357 6:6014496-6014518 TAGATAAAAAGGGACCCGGATGG - Intergenic
1003490535 6:6617357-6617379 AAAATGAAGAGGGGCAGGCAAGG + Intronic
1003497823 6:6679502-6679524 TTGATGAGGAGGGCCAGGAATGG + Intergenic
1004297985 6:14431484-14431506 TAAAGGAAGTGGGCCAGGGAAGG + Intergenic
1004531954 6:16462142-16462164 TAGATGAGGAGGAAGAGGGGAGG - Intronic
1004564801 6:16786268-16786290 AAGATGAAGAAGGACAGGTGCGG + Intergenic
1004660776 6:17707069-17707091 GAAAGGAAGAGGGACGGGGAAGG + Intergenic
1004951002 6:20672134-20672156 GAGAGGGAGAGGGAGAGGGAAGG - Intronic
1005000505 6:21235505-21235527 AAAATGAAGAGAGAGAGGGAGGG + Intergenic
1005063774 6:21798388-21798410 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
1005582762 6:27250111-27250133 AAGATGCAGAGAGACAGAGATGG - Intronic
1006006946 6:31010269-31010291 CACATGAGGAGGGGCAGGGAGGG - Intergenic
1006014353 6:31068093-31068115 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
1006195999 6:32242808-32242830 TGGATGAAGAGGGAAGGAGATGG + Intergenic
1006278727 6:33029087-33029109 GAGATGAAGAGGGAGAGGGGAGG - Intergenic
1006371891 6:33650004-33650026 TGGATGAAGGGGCACAGGGCTGG - Intronic
1006456450 6:34134679-34134701 GAGATGAAGAAAGTCAGGGAGGG - Intronic
1007515327 6:42406281-42406303 GAGATGAAGAGGGAAGAGGAAGG - Intronic
1007840026 6:44708525-44708547 AAGATGAAGAGGTTCAGAGATGG - Intergenic
1007942703 6:45797429-45797451 CAGGTGGAGAGGGACATGGAGGG + Intergenic
1007944207 6:45810860-45810882 CAGAGAAAGAGGCACAGGGAGGG - Intergenic
1009625268 6:66131842-66131864 TAGCTGAAGAGGAAGAGTGATGG - Intergenic
1009869336 6:69434063-69434085 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
1009948908 6:70372390-70372412 CTGATGAGGTGGGACAGGGAGGG - Intergenic
1010247147 6:73672110-73672132 ACAATGAAGAGGGACAGGGTGGG + Intergenic
1010631095 6:78199353-78199375 TAGATGTAGAGGGTCAGGGTGGG - Intergenic
1011207148 6:84912111-84912133 TAGATGAATATGAACAGCGAAGG - Intergenic
1011892814 6:92188307-92188329 TACATGTAGAGAGAGAGGGAGGG + Intergenic
1012312975 6:97751162-97751184 GAAATGAAAAGGGAGAGGGAAGG + Intergenic
1012422429 6:99079419-99079441 GAGAGGGAGAGGGAGAGGGATGG - Intergenic
1012777616 6:103517752-103517774 TAGATGAGGAGATAAAGGGATGG - Intergenic
1013044177 6:106467959-106467981 TAGAGAAAGAGTGGCAGGGAGGG + Intergenic
1013309577 6:108880724-108880746 AAGGAGAAGAGGGAGAGGGAAGG - Intronic
1013941745 6:115672155-115672177 TAGATGTAGATGGTCAAGGAAGG + Intergenic
1014090678 6:117400703-117400725 AAGAAGAAGAGGGACAGCAAAGG - Intronic
1014878025 6:126685447-126685469 TAGTAGAAGAGGGGAAGGGAGGG - Intergenic
1014904320 6:127008126-127008148 TAGATCAAGAGAGACAGGTTAGG + Intergenic
1015196140 6:130526549-130526571 CAGAGGAAGAGGGAGAGAGAAGG + Intergenic
1015233955 6:130949568-130949590 AAGAAGAAAAGGGACAGGGAAGG + Intronic
1015498514 6:133906435-133906457 GAGTGGAAGGGGGACAGGGACGG + Intergenic
1015509976 6:134028811-134028833 TACAAGAAGAGTGGCAGGGATGG + Exonic
1016154307 6:140784523-140784545 TAGATAAAGAGGGGAAGGAAAGG - Intergenic
1016529774 6:145044643-145044665 AAGAAGAAGAAAGACAGGGAAGG - Intergenic
1016686313 6:146886269-146886291 GAGAAGAAGAGGGGCATGGAGGG - Intergenic
1016925762 6:149346105-149346127 TAGATGAAGAGAGGGAGGAAGGG + Intronic
1017201380 6:151758468-151758490 TAGAAGAGGAAGGCCAGGGATGG + Intronic
1017212715 6:151875164-151875186 TAGATGAAGAGGGCCAGGAAGGG - Intronic
1017774812 6:157672653-157672675 GAGGTGGGGAGGGACAGGGATGG - Intronic
1018912194 6:168108253-168108275 TTGAGGAAGAGAGAGAGGGAGGG + Intergenic
1019073028 6:169365591-169365613 AGGAAGAAGAGGGGCAGGGAAGG + Intergenic
1019154195 6:170028030-170028052 GAGATGAAGAGATACAGAGATGG + Intergenic
1019154200 6:170028142-170028164 GAGATGAAGAGAGACAAAGATGG + Intergenic
1019154207 6:170028275-170028297 GAGATGGAGAGAGACAGAGATGG + Intergenic
1019154209 6:170028327-170028349 GAGATGGAGAGAGACAGAGATGG + Intergenic
1019154217 6:170028473-170028495 TAGATGAAGAGATACAGAGACGG + Intergenic
1019154219 6:170028521-170028543 GAGATGAAGACAGACAGAGATGG + Intergenic
1019319171 7:407732-407754 GAGATGAAGAAGCTCAGGGAGGG - Intergenic
1019459314 7:1147962-1147984 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
1019924311 7:4182234-4182256 TAGAGGGAGGGGGACAGAGAGGG - Intronic
1020181099 7:5923020-5923042 TAGAAAAAGAGGGCCAGGGCCGG + Intronic
1020189074 7:5980782-5980804 TCTATTAAGAGGAACAGGGAAGG + Intronic
1020293842 7:6743971-6743993 TCTATTAAGAGGAACAGGGAAGG - Intergenic
1020301834 7:6801868-6801890 TAGAAAAAGAGGGCCAGGGCCGG - Intronic
1020475003 7:8583780-8583802 AAGATAAAGAGGGAATGGGAGGG - Intronic
1020958510 7:14773482-14773504 TAAATGAAGAATGACAGAGAAGG + Intronic
1021079022 7:16341081-16341103 TAGATGTTGGGGGAGAGGGAAGG + Intronic
1021324992 7:19255664-19255686 AAGAAGAAGAAAGACAGGGAAGG - Intergenic
1021452896 7:20798428-20798450 GAGAGGAGGAGGGACAGGGAGGG - Intergenic
1022834389 7:34100052-34100074 CAGTTGAAGAGAGAGAGGGAGGG - Intronic
1023112870 7:36831674-36831696 TTGTTGAAGAGGAACAGGGCAGG + Intergenic
1023202639 7:37715472-37715494 TAGATGAGGAGGAAAAGGAAAGG + Intronic
1023305774 7:38825448-38825470 TAAATAAAGAGGGAGAGAGAGGG - Intronic
1023700739 7:42889421-42889443 AAGAGGAAGAGGGAGAGGGAGGG + Intergenic
1023715917 7:43043789-43043811 TGGATAAATAGGGACAGGGACGG + Intergenic
1023723616 7:43119832-43119854 TGGATGGAGAGGGAGAGAGAAGG - Intronic
1023852398 7:44157746-44157768 CAGATGAAGAGGGACCAGGTCGG + Intronic
1024807046 7:53154060-53154082 TAGATGAAGATGGACTTGGATGG + Intergenic
1027502139 7:78966328-78966350 TAGAGGGAGAGGGAAATGGAGGG - Intronic
1028866954 7:95724795-95724817 TAGATGAAGAGAAAAAGGCAAGG + Intergenic
1028973616 7:96887757-96887779 TAGATGAAGAGAAAAAGAGATGG - Intergenic
1029211882 7:98916038-98916060 TAGATGACCAGGGCCAGGGGAGG - Intronic
1030036494 7:105411762-105411784 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
1030052659 7:105552561-105552583 AAGGTGAAGAGGGCCAGGGATGG - Intronic
1031067013 7:117115929-117115951 GAGATGGAGAGAGAAAGGGAGGG - Intronic
1031537150 7:122948962-122948984 GAGAACAAGAGGGAGAGGGAGGG - Intergenic
1031839706 7:126723159-126723181 TAGATGAAGAGGCAGAGAAAGGG - Intronic
1032090493 7:128909301-128909323 GAGAGGAGGAGGGAGAGGGATGG + Intronic
1032389521 7:131546869-131546891 TAGATGAAGGTGGCCAGGGTGGG - Intronic
1032894435 7:136235113-136235135 GAAAGGAAGAGGGACAAGGAAGG + Intergenic
1032906190 7:136369892-136369914 AAAATGATGAGGGAAAGGGATGG + Intergenic
1033118980 7:138650285-138650307 TTGGGGATGAGGGACAGGGAGGG + Intronic
1033476564 7:141698763-141698785 TAGAGTAAGAGGGAAAAGGAGGG - Intronic
1034717149 7:153254090-153254112 TTGGTGTGGAGGGACAGGGAGGG + Intergenic
1035226965 7:157439039-157439061 AGGCTGAGGAGGGACAGGGATGG - Intergenic
1035389540 7:158496239-158496261 AAGATGAAGGGGTGCAGGGAAGG - Intronic
1035781681 8:2233006-2233028 CAGAAGAAGAGGGTCTGGGAGGG + Intergenic
1035810414 8:2486358-2486380 CAGAAGAAGAGGGTCTGGGAGGG - Intergenic
1035886452 8:3296352-3296374 CAGAGGAAGGGGGACTGGGAAGG + Intronic
1035971267 8:4251872-4251894 TGGAGGAAGAGGGGAAGGGAGGG + Intronic
1036095821 8:5724715-5724737 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1036243942 8:7100967-7100989 TAGAACAAGAGGGCCAGGCATGG + Intergenic
1036445988 8:8822371-8822393 CTGATGCAGAGGGACAGAGATGG + Intronic
1036526255 8:9537629-9537651 TAGATGAAGAGATACAGGGATGG - Intergenic
1036747420 8:11419866-11419888 TGGATGAAGAGGCAGAGGGGTGG - Intronic
1037136114 8:15463040-15463062 TAGAGGAAGAGGAAAAGGGGAGG - Intronic
1037678792 8:21075577-21075599 TAGGTGAAGAGGACCAAGGAGGG - Intergenic
1037742274 8:21617116-21617138 TAGATGGTGAGGGTCAGGGTAGG - Intergenic
1038007253 8:23442813-23442835 CAGAGGAATAGGGGCAGGGATGG - Intronic
1038047462 8:23777894-23777916 TATATAAAGACAGACAGGGAGGG + Intergenic
1038053282 8:23833463-23833485 TAGATGGAGTGGGACAGGGTAGG + Intergenic
1038059616 8:23898563-23898585 TAGAGGAAGAGAGAGAGGTATGG - Intergenic
1038480561 8:27898968-27898990 GAGATGCAGAGGGCCAGGTATGG - Intronic
1038542641 8:28402282-28402304 GGGAGGAGGAGGGACAGGGAAGG + Intronic
1039419508 8:37424275-37424297 GAGATGATGAGGGATTGGGATGG - Intergenic
1039611423 8:38922361-38922383 CAGCTAAAGAGGGCCAGGGAAGG + Intronic
1039992710 8:42503346-42503368 TGGTAGAGGAGGGACAGGGAAGG + Intronic
1039998693 8:42558358-42558380 CAGATGAGGAGAGACACGGATGG + Intergenic
1040547190 8:48407818-48407840 TAAATGATGGGGGACAGGGTTGG - Intergenic
1040818475 8:51533501-51533523 TGGAGGGAGAGGGAGAGGGAGGG - Intronic
1041976734 8:63807889-63807911 TTGGTGAAGAGGGAAAGAGAAGG - Intergenic
1042199733 8:66269707-66269729 TACATGAAGGTTGACAGGGAAGG - Intergenic
1042827512 8:72993594-72993616 TGGAGGAAGCAGGACAGGGAAGG + Intergenic
1044004905 8:86928061-86928083 TAGATGGGGAGGTAGAGGGAAGG + Intronic
1044152353 8:88797185-88797207 GAGGTGAAGAGGGAAAGGAAAGG + Intergenic
1044223502 8:89698127-89698149 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1044223512 8:89698155-89698177 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1044555226 8:93555920-93555942 GAGAGGAAGAGAGACAGGGAGGG - Intergenic
1046248953 8:111604715-111604737 TTGAAGAAGAGGATCAGGGAGGG - Intergenic
1046520283 8:115317477-115317499 GAGATGAGGAAGGACAGAGAGGG - Intergenic
1047369974 8:124248051-124248073 AAGAGGGAGAGGGAGAGGGAGGG + Intergenic
1047438990 8:124859678-124859700 CAGATGTAGAGGGTCAGAGATGG - Intergenic
1047744005 8:127830357-127830379 CAGGTGGAGAGGGGCAGGGATGG + Intergenic
1048508398 8:135041304-135041326 TAGAGGCAGAAGGACAGGTAAGG + Intergenic
1048645464 8:136414660-136414682 AAGATGAAGAGGAGCAGGAAAGG + Intergenic
1049198895 8:141330311-141330333 GAGAAGAAGAGGAAGAGGGAAGG - Intergenic
1049356737 8:142192847-142192869 GGGATGAAGAGGGAGTGGGAGGG + Intergenic
1049413536 8:142484567-142484589 AAGAAAAGGAGGGACAGGGAAGG + Intronic
1050317017 9:4412837-4412859 TGGAGGAAGAGAGATAGGGATGG - Intergenic
1050451087 9:5781851-5781873 AAGATCAAGAGGGACAAAGAAGG + Intronic
1050942189 9:11473279-11473301 TAGAGGAAGAGGAAGAGGAAAGG + Intergenic
1051276681 9:15405815-15405837 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1051389779 9:16551801-16551823 GAGATGAAGAAAGAGAGGGATGG + Intronic
1051496686 9:17731380-17731402 AAGAGGAAGAGGAAAAGGGAGGG + Intronic
1052324619 9:27204389-27204411 TAGAAGAAGAGAGAGAGGGAGGG - Intronic
1052641205 9:31167458-31167480 TTGCTGAAGAGAGCCAGGGAGGG - Intergenic
1053103300 9:35389738-35389760 TAGAGGAAGAGGTATAGGAAGGG + Intronic
1054798161 9:69321731-69321753 TGGAAAATGAGGGACAGGGAGGG + Intergenic
1055137739 9:72842413-72842435 GAGAGGGAGAGGGAGAGGGACGG + Intergenic
1055948089 9:81709518-81709540 GAGACGGAGAGGGAGAGGGAGGG - Intergenic
1056040511 9:82660679-82660701 AAGAGGAAGAGGGAGAGAGAAGG + Intergenic
1056595512 9:88004914-88004936 GAGATGAAGGGGGGAAGGGACGG - Intergenic
1056776696 9:89518275-89518297 AATGTGAAGAGGGGCAGGGAGGG + Intergenic
1056932911 9:90893486-90893508 TAGATGAAGGGAGAGAAGGAGGG + Intronic
1057307527 9:93920871-93920893 AAAATGGAGAGAGACAGGGAAGG - Intergenic
1057424013 9:94934263-94934285 TAGAGGGAGAGGGAGAGGGAAGG - Intronic
1057706369 9:97397958-97397980 GAGAGGAGGAGGGACAGAGAAGG - Intergenic
1058049459 9:100392214-100392236 TGGAGGGAGAGGGAGAGGGAGGG - Intergenic
1058823473 9:108754036-108754058 TAAATGAATAGAGACTGGGATGG - Intergenic
1059100257 9:111464764-111464786 TGAATGAAAAGGGAGAGGGAAGG + Intronic
1059365503 9:113783670-113783692 TAGATGAATAGGGAGATGGATGG + Intergenic
1060041334 9:120304266-120304288 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1060988605 9:127835670-127835692 TAGAGGAACAGGGACAGTGGCGG - Intronic
1061036920 9:128119098-128119120 GGGATGGAGAGGTACAGGGATGG + Intergenic
1061092805 9:128436004-128436026 GAGATGGAGAGGGAGAGAGAAGG - Intronic
1061142313 9:128775035-128775057 AAGAAGAAGAGAGAGAGGGAAGG + Intergenic
1061505460 9:131029369-131029391 CAGATGAAGACAGGCAGGGAGGG + Intronic
1061996660 9:134189655-134189677 GAGAGGAAGAGGGAGAGAGAGGG + Intergenic
1062652389 9:137584697-137584719 TACATGAAAAGGGAAGGGGAAGG - Intronic
1203362832 Un_KI270442v1:232373-232395 CAGAGGAAGAGAGACAGAGATGG + Intergenic
1185636409 X:1555126-1555148 TAGATGAGGAGGGTCAGATAGGG - Intergenic
1186319696 X:8410928-8410950 TAGATGAATAGGTAGATGGATGG - Intergenic
1186814006 X:13217494-13217516 TACATCAAGGGGGAGAGGGAAGG + Intergenic
1187035816 X:15538173-15538195 GAGAGGAAGAGGGAGAGAGAGGG - Intronic
1187631487 X:21177599-21177621 GGGGTGAAGAGGGACAGGTAAGG + Intergenic
1187759828 X:22569354-22569376 GAAAGGAAGAGGGTCAGGGAAGG + Intergenic
1187977867 X:24721965-24721987 TGGATGGGGAGGGAGAGGGAAGG - Intronic
1188031833 X:25272671-25272693 TAGATGAAGGGCCACATGGAGGG + Intergenic
1188079203 X:25815452-25815474 TAGAGGGAGAGGGAGAGAGAAGG - Intergenic
1188317789 X:28696183-28696205 TGCATCAAGAGGGAAAGGGATGG - Intronic
1188652141 X:32644597-32644619 TGGAGGAAAAAGGACAGGGAAGG + Intronic
1189093654 X:38114266-38114288 CAGATGAAGATGGATTGGGAAGG - Intronic
1189328778 X:40130148-40130170 TAGATGAAGAGGGACAGGGAAGG - Intronic
1189593299 X:42538285-42538307 TAGAAGCAGAGCGACAAGGAAGG - Intergenic
1190174575 X:48138568-48138590 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1190915664 X:54809461-54809483 TAGGTGGAGAAGGACAAGGATGG - Intronic
1192195218 X:69023357-69023379 TGGATGAGGGGGCACAGGGATGG + Intergenic
1192380339 X:70610107-70610129 GAAAGGTAGAGGGACAGGGAGGG + Intronic
1192418357 X:71005082-71005104 AAGAGGAAGAGGGATGGGGATGG - Intergenic
1193251925 X:79301106-79301128 TAAATGAAGAAGGACAATGAGGG + Intergenic
1193254950 X:79337257-79337279 TTGAAGCAGAGGGAAAGGGAGGG - Intergenic
1194411279 X:93561736-93561758 AAGAGGAAGAAGGACAGGGAAGG - Intergenic
1194846221 X:98812458-98812480 GAGACGAAGAGGGAGAGGGAGGG + Intergenic
1194861974 X:99010690-99010712 GAGAGAAAGAGAGACAGGGAGGG + Intergenic
1194988727 X:100521346-100521368 GAGAAGAAGAGGGAGAGTGAGGG + Intergenic
1195049119 X:101080587-101080609 TGGGAGAAGAGGGACAGGGTGGG + Intronic
1195310139 X:103624604-103624626 GAAATGCACAGGGACAGGGAAGG - Intronic
1195315619 X:103674840-103674862 GAGACGAAGAGGGGAAGGGACGG - Intergenic
1195484627 X:105389915-105389937 TGGATGGAGAGGGACAGGGTTGG - Intronic
1195864869 X:109420421-109420443 GAGAAGGAGAGGGAAAGGGAGGG + Intronic
1195954101 X:110310530-110310552 TAGGTGAAGAGGGAAAGGGGAGG + Intronic
1197116041 X:122834959-122834981 AAGAGGAAGAGAGAGAGGGAGGG - Intergenic
1197268289 X:124399373-124399395 TATAAAAAGAGGGACATGGATGG - Intronic
1197452771 X:126640750-126640772 GAGAGGGAGAGGGAGAGGGAGGG - Intergenic
1197777783 X:130130794-130130816 TAGAGAAAGAGGGGAAGGGAAGG + Intronic
1198116501 X:133549785-133549807 GAGAAAAAGAAGGACAGGGAGGG - Intronic
1198116513 X:133549829-133549851 GAGAAAAAGAAGGACAGGGAGGG - Intronic
1198401568 X:136273564-136273586 TAGAATAAGAGGGAGAGAGAGGG + Intergenic
1198508785 X:137328195-137328217 TAGATGAAGAGGGCAAGAGGGGG - Intergenic
1198845505 X:140906168-140906190 AAGATGAGGAGGTAGAGGGATGG + Intergenic
1198979651 X:142380353-142380375 GAGAGGGAGAGGGAGAGGGAGGG + Intergenic
1199859168 X:151784270-151784292 AAGAGGAAGAGGGAGAGGGAAGG - Intergenic
1200300288 X:154967482-154967504 TTGATTATGAGGAACAGGGAAGG + Intronic
1200338018 X:155372670-155372692 TAGAGGGAGAGGGAAAAGGAGGG + Intergenic
1200348451 X:155468024-155468046 TAGAGGGAGAGGGAAAAGGAGGG - Intergenic
1202087278 Y:21152154-21152176 TTGAGGAAGAGGGATAGGGGAGG + Intergenic
1202597338 Y:26554858-26554880 GAGAGAATGAGGGACAGGGATGG + Intergenic