ID: 1189329755

View in Genome Browser
Species Human (GRCh38)
Location X:40136655-40136677
Sequence CCAAAGCTTTGGTAGGCGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189329751_1189329755 -9 Left 1189329751 X:40136641-40136663 CCTGCTATAAATGTCCAAAGCTT 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1189329755 X:40136655-40136677 CCAAAGCTTTGGTAGGCGTATGG 0: 1
1: 0
2: 1
3: 3
4: 107
1189329750_1189329755 10 Left 1189329750 X:40136622-40136644 CCAAGATATTGTTTTTGTTCCTG 0: 1
1: 0
2: 3
3: 50
4: 490
Right 1189329755 X:40136655-40136677 CCAAAGCTTTGGTAGGCGTATGG 0: 1
1: 0
2: 1
3: 3
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189329755 Original CRISPR CCAAAGCTTTGGTAGGCGTA TGG Intronic
902227560 1:15006286-15006308 CTAAATCTTTGCTAGGCTTAGGG + Intronic
903116619 1:21183555-21183577 TCAATGCTTTGGGAGGCCTAGGG + Intergenic
905549097 1:38821943-38821965 CCAAAGCTTTGGTAAGGTGAGGG - Intergenic
905751755 1:40471347-40471369 CCAACACTTTGGGAGGCCTAGGG + Intergenic
909721632 1:78777977-78777999 CCATAACTTTGGTAGCTGTATGG - Intergenic
911026843 1:93445827-93445849 CCAAAACTTTGGGAGGCTGAGGG + Intergenic
917007947 1:170436413-170436435 CCTAACCTTTAGTAGGCTTATGG - Intergenic
917596375 1:176533076-176533098 CCAAAGCTTTGACAGGAATAAGG - Intronic
917655764 1:177123808-177123830 CCAAACCTTTGGGAGGCCTCAGG + Intronic
918872753 1:189997619-189997641 CCAGTGCTTTGGGAGGCCTAGGG - Intergenic
920336222 1:205247140-205247162 CCTCAGCTTTGTTAGGTGTATGG + Intronic
924289212 1:242520955-242520977 CCAGAGCTTTGGAAGGCATTAGG - Intronic
924667733 1:246090764-246090786 CCAGCGCTTTGGGAGGCGGAGGG - Intronic
1065785646 10:29211522-29211544 CCAAAACTTTGGGAGGCTGAAGG - Intergenic
1073059854 10:100727063-100727085 CCAAGGCTTGGGTGGGGGTAGGG + Intergenic
1074553630 10:114468521-114468543 CCAAAACTTTGGGAGGCTAAGGG - Intronic
1081559147 11:44197006-44197028 CCAAAGCATTGGTAGCCATGTGG - Intronic
1081753400 11:45527970-45527992 CCAAAGATTTGGAAGGCGCAGGG - Intergenic
1083155923 11:60822722-60822744 CCAGAGCTTTGGGAGGCTGAGGG + Intergenic
1084912461 11:72402006-72402028 CCAACACTTTGGTAGGCTGAGGG + Intronic
1085030519 11:73268372-73268394 CCAAAACTTTGGGAGGCTGAGGG + Intronic
1090325925 11:125886685-125886707 CCAGAGCTTTGGGAGGCCGAGGG + Intronic
1094035560 12:26066761-26066783 CCAAGGATTTGGTAGGGGTTGGG - Intronic
1096126962 12:49126720-49126742 CCAACGCTTTGGGAGGCTTGAGG - Intergenic
1096712805 12:53469993-53470015 CCAACGCTTTGGGAGGCTGAAGG - Intronic
1102194491 12:111014888-111014910 CCAAAGCTTTGGAATTCGAAAGG + Intergenic
1113725221 13:112593424-112593446 CCAAAACTTTGGGAGGCCAAGGG + Intergenic
1117297174 14:54391146-54391168 CCAGCGCTTTGGGAGGCGGAGGG - Intergenic
1120616191 14:86708054-86708076 CCAGAACTTTGGGAGGCCTAGGG + Intergenic
1121559297 14:94862668-94862690 CCAACACTTTGGGAGGCCTAGGG - Intergenic
1127414099 15:58740161-58740183 CCAAAACTTTGGGAGGCTGAAGG + Intronic
1131191165 15:90317997-90318019 CCAATGCTTTGGGAGGCTGAGGG + Intergenic
1133402033 16:5495254-5495276 CCAAAGTTTTGCTAGGCTGATGG - Intergenic
1135125301 16:19804676-19804698 CCAACACTTTGGGAGGCGGAGGG - Intronic
1137024659 16:35460603-35460625 CCAACACTTTGGTAGGCTGAGGG + Intergenic
1138005787 16:53336051-53336073 CCAGAGCTTTGGAAGGCTGAGGG - Intergenic
1138623605 16:58231706-58231728 CCAACACTTTGGGAGGCCTAAGG - Intronic
1139278122 16:65746926-65746948 CCCAAGCTTTGGAAGGGGTGAGG - Intergenic
1140023918 16:71266202-71266224 CCAAAACTTTGGGAGGCTGAGGG + Intergenic
1141838513 16:86559177-86559199 CCCAAGCTGTGGCAGGCGCATGG - Intergenic
1143988522 17:10936630-10936652 GCAAAGCTTTGGCAGGCACAAGG - Intergenic
1147199462 17:38790435-38790457 CCAACACTTTGGGAGGCCTAAGG + Intronic
1149180795 17:53933566-53933588 TCAAAGCTTTGGTAGAGGTCTGG - Intergenic
1152650987 17:81492754-81492776 CCAACACTTTGGGAGGCCTAGGG + Intergenic
1157807854 18:50671640-50671662 CCAGAGCTTTGGGAGGCTTTGGG + Intronic
1158253608 18:55519180-55519202 CCAAAACTTTGGGAGGCCCAAGG + Intronic
1160506750 18:79431638-79431660 CCAAAACTTTGGGAGGCCAAGGG - Intronic
1160929773 19:1564967-1564989 CCGAAGCTGTGGAAGACGTAAGG + Intronic
1162057968 19:8076381-8076403 CCAGTGCTTTGGGAGGCCTAGGG + Intronic
1163018194 19:14469628-14469650 CCAAAGCTCTGGGAGGCTGAGGG - Intronic
1163402524 19:17102649-17102671 CCAATGCTTTGGAAGGCTGAGGG + Intronic
1166395503 19:42437184-42437206 CCAACGCTTTGGGAGGCCGAGGG - Intronic
925068375 2:947968-947990 CCAAAGCCTTGGAAGGGGGAAGG + Intergenic
928568797 2:32582106-32582128 CCAACACTTTGGGAGGCGGAGGG - Intronic
929862276 2:45689658-45689680 CCAATGCTTTGGGAGGCCGAGGG + Intronic
930187811 2:48427725-48427747 CCAACACTTTGGGAGGCCTAAGG + Intergenic
938828541 2:135031414-135031436 TCAAAGCTTTGGAAGGAGTTAGG + Intronic
942674536 2:178413443-178413465 CCAGCACTTTGGGAGGCGTAAGG - Intergenic
943022131 2:182588110-182588132 ACAAAGCTTTGGTTTGAGTAAGG - Intergenic
945882338 2:215339268-215339290 CCAACACTTTGGTAGGCCAAGGG + Intronic
946696163 2:222361669-222361691 GCAAAGTTTTGGTAGGGGTTAGG + Intergenic
946927148 2:224637145-224637167 CCAGAGCTCTGGTAGGCCTAAGG + Intergenic
948965718 2:241378362-241378384 CCAAAACTTTGGGAGGCCGAGGG - Intronic
1170091414 20:12593207-12593229 AGAAAGCATTGGTAGGGGTATGG - Intergenic
1177349012 21:19911122-19911144 CCAATGCTTTGGGAGGCCAAGGG + Intergenic
1178955112 21:37014975-37014997 CCAACGCTTTGGGAGGCCGAGGG - Intronic
1183120108 22:35723709-35723731 CCAAAACTTTGGGAGGCCGAGGG + Intronic
1184632740 22:45796746-45796768 TCAATGCTTTGGGAGGCGGAAGG - Intronic
950934755 3:16827367-16827389 TCAAAGCTTTGGAAGATGTAAGG - Intronic
957304543 3:78440892-78440914 CCAAAGCTGTGGTAGGTGTATGG + Intergenic
960936611 3:122908025-122908047 CCAACACTTTGGTAGGCTGAGGG + Intergenic
971077635 4:23168308-23168330 CCAACACTTTGGGAGGCTTAAGG + Intergenic
980412731 4:132445031-132445053 CCAAAGCTTTTGTAGGTTTCAGG + Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
988447211 5:31300869-31300891 CCAGAGCTTTGGGAGGCTGAGGG + Intronic
989745236 5:44821198-44821220 TCAAAGCATTGGTCGGGGTAGGG + Intergenic
994172467 5:96672458-96672480 CCAACGCTTTGGGAGGCTGAGGG + Intronic
997231190 5:132244507-132244529 CCAAAGCCTTGACAGGAGTAGGG - Intronic
999253913 5:150199032-150199054 CCAAAGCTGAGGAAGGGGTAAGG + Intronic
999987432 5:157017250-157017272 CCAGAGCTTTGGGAGGCCAAGGG + Intergenic
1001776961 5:174336347-174336369 CCAAAGCTGGGGAAGGTGTATGG - Intergenic
1007535273 6:42581574-42581596 ACAACACTTTGGTAGGCTTAGGG - Intronic
1008128164 6:47691528-47691550 CCAAAGGTTAGGTAAGAGTAAGG - Intronic
1012443748 6:99287853-99287875 CCAAAGATTTAGAAGGGGTATGG + Intronic
1014920191 6:127205320-127205342 GCAAAGCTTTGCTAGGAGTGGGG + Intergenic
1016386961 6:143537854-143537876 CCAGAGCTTTGGGAGGCCCAAGG + Intronic
1016396196 6:143626199-143626221 CTAAAGGTTTGGCAGGGGTAAGG - Intronic
1023702601 7:42907229-42907251 CCAAAACTTTGGGAGGCTGAGGG - Intergenic
1026551880 7:71375667-71375689 CCAGAGCTTTGGAAGGCCCAGGG - Intronic
1027419196 7:78003483-78003505 CCAAAACTTTGGGAGGCATATGG - Intergenic
1029247204 7:99210833-99210855 CCAATGCTTTGGGAGGCTGAGGG - Intergenic
1034893919 7:154863149-154863171 CCAATGCTTTGGGAGGCCAAGGG - Intronic
1035868816 8:3113966-3113988 CCAGCACTTTGGTAGGCTTAGGG + Intronic
1037303642 8:17481675-17481697 CCAAAACTTTGGGAGGCCGAGGG + Intergenic
1037993154 8:23335062-23335084 CCAACGCTTTGGGAGGCCGAGGG - Intronic
1039502313 8:38027856-38027878 CCAACACTTTGGTAGGCCGAGGG - Intergenic
1041667620 8:60461267-60461289 CCAACGCTTTGGGAGGCCGAGGG + Intergenic
1046095376 8:109552844-109552866 CCAATGCTTTGGGAGGCCGAGGG + Intronic
1046223032 8:111240077-111240099 CAAAATCTTTGGTAGGCCTTTGG + Intergenic
1046365000 8:113216702-113216724 TCAAAGCTTTCGTTGGCATATGG + Intronic
1048509215 8:135047214-135047236 CCAACGCTTTGGGAGGCCGAGGG - Intergenic
1049559083 8:143298807-143298829 CCAACACTTTGGGAGGCCTAAGG + Intergenic
1053810975 9:41851549-41851571 CCAACACTTTGGTAGGCTGAGGG + Intergenic
1054619619 9:67335890-67335912 CCAACACTTTGGTAGGCTGAGGG - Intergenic
1054767472 9:69054247-69054269 CCAAAACTTTGGAAGGCTGATGG - Intronic
1059495693 9:114707373-114707395 CCAAAGCTCAGGCAGGCATAGGG - Intergenic
1060267031 9:122117863-122117885 CCAGAGCTTTGGGAGGCCAAGGG + Intergenic
1061641170 9:131957503-131957525 CCAATGCTTTGGGAGGCCAAAGG - Intronic
1188091555 X:25970498-25970520 CCAAAACTTTGGGAGGCCAAAGG - Intergenic
1189329755 X:40136655-40136677 CCAAAGCTTTGGTAGGCGTATGG + Intronic
1196672350 X:118382116-118382138 CCAATGCTTTGGGAGGCCAAGGG - Intronic
1199357485 X:146878634-146878656 CTAAAGCTTTGGGAGGTCTAGGG + Intergenic