ID: 1189335449

View in Genome Browser
Species Human (GRCh38)
Location X:40168354-40168376
Sequence GTCTCTTGCCTCTGCCGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189335438_1189335449 22 Left 1189335438 X:40168309-40168331 CCCTACACGCGCGGAGAGGACGC 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1189335449 X:40168354-40168376 GTCTCTTGCCTCTGCCGGGAGGG 0: 1
1: 0
2: 2
3: 11
4: 175
1189335439_1189335449 21 Left 1189335439 X:40168310-40168332 CCTACACGCGCGGAGAGGACGCG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1189335449 X:40168354-40168376 GTCTCTTGCCTCTGCCGGGAGGG 0: 1
1: 0
2: 2
3: 11
4: 175
1189335445_1189335449 -9 Left 1189335445 X:40168340-40168362 CCGGGCTTTGTTTTGTCTCTTGC 0: 1
1: 0
2: 5
3: 42
4: 482
Right 1189335449 X:40168354-40168376 GTCTCTTGCCTCTGCCGGGAGGG 0: 1
1: 0
2: 2
3: 11
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189335449 Original CRISPR GTCTCTTGCCTCTGCCGGGA GGG Intronic
900460624 1:2800784-2800806 GTGGCCTGCCTCTGCCGGGAGGG - Intronic
900518757 1:3095698-3095720 GCCTCTGGCCTCGGCCAGGAGGG + Intronic
900596542 1:3482690-3482712 GCTTCCTGACTCTGCCGGGAGGG - Intergenic
900637836 1:3674602-3674624 GTCCTTAGCCTCTGTCGGGAGGG + Intronic
900919766 1:5662774-5662796 GCCTCCTGCCCCTGCTGGGAAGG - Intergenic
901492513 1:9603635-9603657 GTCACCTGGGTCTGCCGGGATGG + Intronic
901590631 1:10338746-10338768 TCCTCTGGCCTGTGCCGGGAAGG + Intronic
901630038 1:10643521-10643543 GTCACTCGCCTCTGCCAGGCTGG - Intronic
901688613 1:10958510-10958532 GCCTCAGGCCTCTGCCTGGAGGG + Intronic
901800172 1:11703943-11703965 ATCTCCTGGCTCTGCAGGGAAGG + Intronic
903690468 1:25169640-25169662 GTCTCTTGCCTCTCCCAACAAGG + Intergenic
904300423 1:29550209-29550231 GGCTCCTGCCTCTGCCTGGGTGG + Intergenic
904380558 1:30107672-30107694 TGCTCTTCCCTCTGCCTGGAGGG + Intergenic
904582170 1:31552517-31552539 GTCTGGTGCCTCTGCTGGGATGG + Intergenic
905445427 1:38025673-38025695 GTCTCTTGCCCCTGCTGGGTGGG + Intergenic
905481387 1:38264416-38264438 GTGTCATGCCTCTGCAGGGCAGG + Intergenic
906187624 1:43872925-43872947 GGCTGTTTCCTCTGCCTGGAAGG - Intronic
906202699 1:43970345-43970367 GTGGCTCGCCTCTGTCGGGATGG + Intronic
906993465 1:50764281-50764303 GTCTTTTTCCTCTGGTGGGAAGG + Intronic
908387090 1:63653065-63653087 GCCTCTGGCATCTGCCAGGAGGG + Intronic
911164045 1:94709374-94709396 GGCTGTTCCCTCTGCCTGGAAGG + Intergenic
912215601 1:107607582-107607604 GTCTCCTGCCACTGCAGGAAAGG + Intronic
912721091 1:112020759-112020781 GTCTCTCCCTTCTGCCGGGTGGG + Intergenic
914829757 1:151162005-151162027 GTCTCTGGGCTCTGTCAGGATGG + Exonic
916623151 1:166523910-166523932 TTCTGTTCCCTCTGCCTGGAGGG - Intergenic
920363435 1:205435287-205435309 GTCTCTTGCCACTGCCATGGAGG + Intronic
921133417 1:212239108-212239130 GTATTATGCCTCTGCTGGGAAGG - Intergenic
923241761 1:232092398-232092420 GTCTTGTGCCTCAGCTGGGAAGG - Intergenic
1067571599 10:47375848-47375870 GCCTCCTGCCTCTTCCAGGAGGG - Intronic
1069417551 10:68214343-68214365 TTCTTCTGCCTCTGCCTGGAAGG + Intergenic
1072980786 10:100095390-100095412 CTCTCTTCCTTCTGCCTGGACGG - Intergenic
1074536940 10:114334803-114334825 GTCTCCTGCCTCTCCCTGCAGGG - Intronic
1077494527 11:2880486-2880508 GCCTCTGCCCTCTGCCTGGATGG + Intergenic
1077886189 11:6390047-6390069 GTGTGTTGCCTCTGACAGGAAGG - Intergenic
1078129879 11:8604713-8604735 GACTCTTCCCTCTGCTTGGAAGG - Intergenic
1078550132 11:12274610-12274632 TGCTCTTGCTTCTGCCTGGAAGG - Intergenic
1079526393 11:21394087-21394109 GTATATTGCCTGTGCCAGGATGG + Intronic
1080155799 11:29109277-29109299 GTATCTTCCCTGTGCCTGGAGGG - Intergenic
1080613689 11:33927339-33927361 GTCTCTTGCTTCTGTCGTGGAGG - Intergenic
1081665962 11:44917285-44917307 CTCTGTTACCTCTGCCAGGAAGG - Intronic
1083984825 11:66206814-66206836 GGGTCTTCCCTCTGCCTGGAAGG - Intronic
1084072267 11:66744398-66744420 GACCCTTCCCTCGGCCGGGAGGG - Intergenic
1084909392 11:72375472-72375494 GACTGTTCCCTCTGCCTGGAAGG + Intronic
1085290505 11:75395944-75395966 GTCTCTTTCCTAAGCCAGGAAGG + Intergenic
1092387533 12:8047712-8047734 GTCTCTTGTACCTGCCAGGAGGG + Intronic
1101259875 12:103018182-103018204 GCCTCTGGCCTCTGATGGGAGGG + Intergenic
1102261227 12:111444727-111444749 GGCTCTGGCCACTGCAGGGAAGG - Intronic
1102330159 12:112022215-112022237 GTCTTCTACCTCTTCCGGGATGG + Exonic
1103447186 12:121001943-121001965 GCCTCCTGCCTCTACTGGGAAGG + Exonic
1108955758 13:56155272-56155294 GTCTCTTGCCTCAGCCTCGGGGG - Intergenic
1109866748 13:68273780-68273802 GCCTCTTGCCTTTCCTGGGAAGG + Intergenic
1110379488 13:74834238-74834260 GTCTGATGCCTCAGCTGGGATGG + Intergenic
1111409447 13:87855044-87855066 GGCTCTTACCTCTGGGGGGATGG - Intergenic
1112315855 13:98361520-98361542 CTCTCTTGCCACTGCCAGGGTGG - Intronic
1113847671 13:113401837-113401859 GCCACTGGCGTCTGCCGGGATGG + Intergenic
1115289302 14:31752071-31752093 GCCTCTGGCCTGTGCTGGGAGGG + Intronic
1116233264 14:42245713-42245735 GTCTATTGGCTATGCTGGGAAGG - Intergenic
1118745707 14:68771580-68771602 GAATCTTGCCTCTGCCTGGGTGG - Intergenic
1119664663 14:76476832-76476854 TTCTCTTGCCCCAGCCTGGAAGG - Intronic
1119740611 14:77011704-77011726 GTCTCTTGGCTCTGACGGGAAGG - Intergenic
1121802468 14:96786094-96786116 ATCTCTTGACTCTCCAGGGATGG - Intergenic
1122486038 14:102080680-102080702 TTCTCCTGCCTCAGCCAGGATGG + Intergenic
1122969766 14:105147798-105147820 TTCTCCTGCATCTGCCGGGACGG - Exonic
1202856563 14_GL000225v1_random:54862-54884 TTCTCTAGACTCTGCAGGGAGGG - Intergenic
1202922333 14_KI270723v1_random:36707-36729 TTCTCTAGGCTCCGCCGGGAGGG - Intergenic
1125118322 15:36121727-36121749 CTCTGTTGCCTTTGCCTGGAAGG - Intergenic
1129352922 15:74967641-74967663 GTCTAGTGCCTCTGCTGGGGTGG + Intronic
1131283385 15:91038782-91038804 CTCCCTTGCATCTGCTGGGAAGG - Intergenic
1131419047 15:92288175-92288197 GCCTCCTGCCACTCCCGGGATGG + Intergenic
1132085838 15:98907696-98907718 CTTTCTTGCCTCTCCAGGGATGG + Intronic
1132383374 15:101382238-101382260 CTCTCCTGCCTCTCCCAGGAAGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1133531722 16:6661314-6661336 TTCTGTTCCCTCTGCCAGGAGGG - Intronic
1139383871 16:66551531-66551553 GTTTCTCACCTCTCCCGGGAGGG + Intronic
1140754360 16:78054269-78054291 GCTCCTTGCCTCTGCCTGGAGGG - Intronic
1141402809 16:83765206-83765228 GACTCTACCCTCTGCCTGGATGG - Intronic
1141425081 16:83939618-83939640 GTTTCCTTCCTCTGCCGGGGTGG - Intronic
1142594003 17:1020852-1020874 TTCTCCTGCCTCTGCCCGGAGGG + Intronic
1143860356 17:9886064-9886086 TGCTCTTGCCTCTGCCTGGTGGG - Intronic
1145737089 17:27240545-27240567 GTCTCTTCCCTCTGGCTGGTTGG + Intergenic
1148166243 17:45485809-45485831 TTCTCCTGCCTCAGCCGGTATGG - Intronic
1150397467 17:64832532-64832554 TTCTCCTGCCTCAGCCGGTATGG - Intergenic
1151440995 17:74129018-74129040 GTCTCTTGGCTCAGCCCTGATGG - Intergenic
1152382803 17:79950870-79950892 CTAACTTCCCTCTGCCGGGAGGG + Intronic
1158057541 18:53299621-53299643 GTCTCTTTCCTCAGCCAGAATGG + Intronic
1159701227 18:71630734-71630756 GACTCTTGCCTCTGCCTGGACGG - Intergenic
1160928879 19:1560403-1560425 GGCTCTGCCCTCTGCCGGGTCGG - Intronic
1163689952 19:18733118-18733140 GGCTCTTTCCCCAGCCGGGAGGG - Intronic
1165257548 19:34588886-34588908 GTCTCTGACCTCTGCCAGGGTGG - Intergenic
1165323181 19:35098887-35098909 GTCTCTGACCTCTGCCAGTATGG + Intergenic
1165389979 19:35533324-35533346 GTCCCATGCCTCTACGGGGATGG + Intergenic
1165844600 19:38810046-38810068 GGCTGTTCCCTCTGCCTGGAAGG + Intronic
1166379709 19:42349569-42349591 GCCTCTTCCCTCTGCCTGGGCGG + Exonic
1166740194 19:45109913-45109935 GACTCTTCCCTCTGTCTGGAAGG + Intronic
1167953708 19:53047640-53047662 GTCTCATGCCTCTCCCTGCAAGG - Intronic
925290259 2:2743372-2743394 GTCACTGGCCTCTGCCTGGGCGG + Intergenic
927431451 2:23029649-23029671 CTCTCATGCCTCTGCCTGCAAGG - Intergenic
927842650 2:26455321-26455343 CTCCCTTGCCTCTGACGGGGAGG - Intronic
928672148 2:33612604-33612626 GTATTTTGCTTCTGCTGGGATGG + Intergenic
928719342 2:34101212-34101234 GTCTCTTGCCTGGGCCCTGATGG + Intergenic
930102217 2:47612181-47612203 GTCTCTTCCCACTGAAGGGATGG + Intergenic
930238247 2:48908615-48908637 GTCTCCTGCCTTGGCTGGGAGGG - Intergenic
932571465 2:72940604-72940626 GACTCTTGGTTCTGCAGGGAAGG + Intergenic
933796594 2:85924909-85924931 GTGTCTTCCCTCTGCTGGGCGGG - Intergenic
934503905 2:94877546-94877568 GGCTCTTGTCTCAGCCTGGAGGG + Intergenic
934973801 2:98786267-98786289 GTCTCTAGCCAGTGCCAGGAAGG + Intergenic
937049129 2:118874334-118874356 GTCTCTTGGCTTTGGCTGGATGG - Intergenic
937644778 2:124254377-124254399 GTCTGTTGGCTCTGCTGGTAAGG + Intronic
937928064 2:127183027-127183049 TGTGCTTGCCTCTGCCGGGAAGG + Intergenic
939958621 2:148547078-148547100 CTCTCTTGCCCCTGCCAGCATGG - Intergenic
943554743 2:189388364-189388386 GTCTGTTCCCTCTGCCTGGAAGG - Intergenic
948224186 2:236296091-236296113 GTCCCTTGCCCCTGCTTGGAGGG + Intergenic
948618433 2:239216769-239216791 GCCCCTTCCCTGTGCCGGGATGG + Intronic
948776992 2:240294342-240294364 GTCTCTGGCCCCTGCAGTGAAGG - Intergenic
948965056 2:241372753-241372775 CTCTCTTGCCTCTGCTGGGTGGG + Intronic
949009135 2:241668484-241668506 GTCCCTTTCCTCTGCCGGCTCGG + Intronic
949070156 2:242019572-242019594 GTCTCTCCCCTCTGCCGGACAGG - Intergenic
1169321006 20:4633186-4633208 GTCTCATGGCTCTGCAGGGCTGG - Intergenic
1169919668 20:10721301-10721323 GTCTCATGCCTCTCCTGGGAGGG + Intergenic
1170373982 20:15679786-15679808 GTGTGGTGCCTCTGCTGGGATGG - Intronic
1170930772 20:20768093-20768115 GGCTGTTCCCTCTGCCTGGAAGG + Intergenic
1171289105 20:23970147-23970169 GTCTCTTGACTCTGCCCTCAGGG + Intergenic
1174649268 20:52110761-52110783 GTCTTCTACCTCTCCCGGGAGGG - Intronic
1174721200 20:52814519-52814541 GTCTGTTGCCTCAGCTGTGATGG - Intergenic
1177498983 21:21925867-21925889 CTCTCTGGCCCCTGCCGGCAAGG - Intergenic
1181388881 22:22564811-22564833 GACTCTTGCCTGTGCCGTGAGGG - Exonic
1184232941 22:43168311-43168333 GTCTCTTGACTTTGCTGGGGAGG + Intronic
1184657392 22:45948605-45948627 GCCTCTTGCCACAGCCTGGAGGG + Intronic
1185053028 22:48563569-48563591 GGCTCTTGCTGCTGCCGGGCAGG + Intronic
949219255 3:1609914-1609936 GTCTCTTCCCTTTGCTGAGAAGG - Intergenic
950372432 3:12542491-12542513 TTCTCTTGCCTCAGCGGGTAAGG + Intronic
952252327 3:31666466-31666488 CTCCTTTGCCTCTGCAGGGAAGG + Intronic
954713867 3:52517550-52517572 GTCTCCTGCAGCTGCCGTGAGGG + Exonic
954929018 3:54264022-54264044 GTCTCTTCCTTCTGCCTGTATGG - Intronic
958165882 3:89877374-89877396 GTGCCTTGACTCTGCAGGGACGG + Intergenic
959581148 3:107983846-107983868 CTCTCCTGCTTCTGCCTGGAGGG + Intergenic
961381010 3:126496549-126496571 GACTGTTCCCTCTGCCTGGAAGG - Intronic
961555406 3:127693545-127693567 CTCTCTTGCCTCAGTCTGGAAGG + Intronic
963767202 3:149350114-149350136 GTCTCTTGGCTGTGCTAGGATGG + Intergenic
968478717 4:824814-824836 GTCTGAAGCCTCTGCAGGGAGGG + Intronic
971098804 4:23439178-23439200 GTCTGTTGCCTCAGTTGGGATGG + Intergenic
976755545 4:88493712-88493734 TTCTCTTGCCTCAGCCTGGCGGG + Intronic
980901926 4:138913246-138913268 GTCTCTTGCCTTAGGCTGGAGGG - Intergenic
985540653 5:485952-485974 GACTCTTGCTTCTCCAGGGACGG + Intronic
985828111 5:2207742-2207764 GGTTCTTGCCTCTGCAGGAAAGG - Intergenic
986377216 5:7144386-7144408 GTCTCTAGCCTCTGCCAGATAGG - Intergenic
988454264 5:31373327-31373349 CTCTGTTGCCTCTGCAGGGGTGG + Intergenic
989146760 5:38257890-38257912 GTTGCCTTCCTCTGCCGGGAAGG + Intergenic
995132230 5:108642721-108642743 GTCTCTTACCACAGCCAGGAAGG + Intergenic
996177162 5:120373049-120373071 GTCTCTGACCACTGCTGGGAAGG - Intergenic
996631481 5:125638623-125638645 GTCTCCTGTCTCTTCCTGGAAGG + Intergenic
998216500 5:140241705-140241727 GTCCCTTCCATCTGCCTGGATGG - Intronic
999298003 5:150472642-150472664 CACTCTTGCCTTTGCTGGGAAGG - Intergenic
1001381745 5:171310295-171310317 GTACCTGGCCTCTGCCGAGAGGG + Exonic
1003874885 6:10426360-10426382 CGCTCGGGCCTCTGCCGGGAGGG + Intergenic
1005730951 6:28696275-28696297 GTTTCTTGCCTCCACCAGGAAGG + Intergenic
1007238997 6:40411652-40411674 GGCTCTTCCTTCTGCCTGGAGGG + Intronic
1018100636 6:160436070-160436092 GTCTCTTACCTCTGCATGGAGGG - Intronic
1018463583 6:164022035-164022057 GGTTCCTGCCTCTGCCAGGAGGG + Intergenic
1019927526 7:4203112-4203134 GCCTCCTGCCTCTGCGGGAAGGG - Intronic
1020114706 7:5470109-5470131 ATCTCTAGCCCCTGCTGGGAAGG - Intronic
1023849827 7:44144484-44144506 GTCTCTTGCACCTGCTGCGAGGG + Exonic
1028871221 7:95772980-95773002 GTCTCTCGGCTCTGCCGAGAGGG - Intronic
1032836982 7:135683657-135683679 GTTTCTTGCCTGGGCCGGGGTGG + Intronic
1033228147 7:139576806-139576828 GGCTCTTGCCCCTGCTGGGCTGG - Intronic
1035093150 7:156331015-156331037 GCCTCTTTCCCCTGCCGGCAGGG - Intergenic
1037773094 8:21814526-21814548 GTCTCTTACCTCTGGGTGGAGGG - Intergenic
1037804655 8:22052394-22052416 CTCTCCTGCCTCTGCCTAGAGGG - Intronic
1038567828 8:28634563-28634585 ATCTCTTCCCTCTTCCAGGATGG - Intronic
1039910112 8:41819771-41819793 CTCTCTGGCCTCTGCCAGGCTGG - Intronic
1040333031 8:46401941-46401963 GTCTCTAGCCTCTACTAGGAAGG + Intergenic
1041197084 8:55410972-55410994 CACTCGTGCCTCTGCCAGGAAGG + Intronic
1041197836 8:55418747-55418769 GGCTGTTTCCTCTGCCTGGAAGG + Intronic
1042940569 8:74103193-74103215 GTGTATTGCCTCTGCAGGGTCGG - Intergenic
1044543869 8:93437325-93437347 TTCTCTTGGCTCTTCCTGGAAGG + Intergenic
1044604255 8:94035228-94035250 GTCTCTGGCCTCTCCCTGGGTGG + Intergenic
1045320606 8:101079362-101079384 TTCTCTAGCCTCTTCAGGGAAGG + Intergenic
1049514185 8:143044719-143044741 GTCTCGTGCCCCTTCCTGGATGG - Exonic
1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG + Intronic
1052334545 9:27306319-27306341 GTCAATTACCTCTGCCGGTATGG + Intergenic
1055777285 9:79780076-79780098 GTCTGTTTCCTCTGCCAGGCTGG + Intergenic
1060015112 9:120080282-120080304 GGCTGTTCCCTCTGCTGGGAGGG - Intergenic
1060470354 9:123943172-123943194 GTGTCTTACCTCTCCTGGGAGGG - Intergenic
1062522608 9:136964464-136964486 GTCTCCTTCCTCTGCCGAGCAGG - Intergenic
1203745316 Un_GL000218v1:38038-38060 GGCTCTTGTCTCAGCCTGGAGGG - Intergenic
1203564794 Un_KI270744v1:81446-81468 GGCTCTTGTCTCAGCCTGGAGGG + Intergenic
1189335449 X:40168354-40168376 GTCTCTTGCCTCTGCCGGGAGGG + Intronic
1198620156 X:138499136-138499158 ATCTCTTGCCTCTGCATGCATGG - Intergenic
1199368373 X:147015933-147015955 GTCTCTTGCATCAGCATGGATGG + Intergenic