ID: 1189336611

View in Genome Browser
Species Human (GRCh38)
Location X:40174352-40174374
Sequence AGACGCTCCCAGCCAGCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189336605_1189336611 1 Left 1189336605 X:40174328-40174350 CCTTCACAGCCTCCGGCCCCTAC 0: 1
1: 0
2: 0
3: 16
4: 247
Right 1189336611 X:40174352-40174374 AGACGCTCCCAGCCAGCCTCCGG 0: 1
1: 0
2: 1
3: 41
4: 211
1189336600_1189336611 26 Left 1189336600 X:40174303-40174325 CCTCAGGGTCACCTCTGGGGCTT 0: 1
1: 0
2: 0
3: 39
4: 294
Right 1189336611 X:40174352-40174374 AGACGCTCCCAGCCAGCCTCCGG 0: 1
1: 0
2: 1
3: 41
4: 211
1189336601_1189336611 15 Left 1189336601 X:40174314-40174336 CCTCTGGGGCTTCCCCTTCACAG 0: 1
1: 0
2: 3
3: 32
4: 270
Right 1189336611 X:40174352-40174374 AGACGCTCCCAGCCAGCCTCCGG 0: 1
1: 0
2: 1
3: 41
4: 211
1189336604_1189336611 2 Left 1189336604 X:40174327-40174349 CCCTTCACAGCCTCCGGCCCCTA 0: 1
1: 0
2: 0
3: 14
4: 231
Right 1189336611 X:40174352-40174374 AGACGCTCCCAGCCAGCCTCCGG 0: 1
1: 0
2: 1
3: 41
4: 211
1189336603_1189336611 3 Left 1189336603 X:40174326-40174348 CCCCTTCACAGCCTCCGGCCCCT 0: 1
1: 0
2: 1
3: 28
4: 405
Right 1189336611 X:40174352-40174374 AGACGCTCCCAGCCAGCCTCCGG 0: 1
1: 0
2: 1
3: 41
4: 211
1189336606_1189336611 -8 Left 1189336606 X:40174337-40174359 CCTCCGGCCCCTACAAGACGCTC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1189336611 X:40174352-40174374 AGACGCTCCCAGCCAGCCTCCGG 0: 1
1: 0
2: 1
3: 41
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189336611 Original CRISPR AGACGCTCCCAGCCAGCCTC CGG Intronic
900435713 1:2629593-2629615 GCCCGCTCCCAGCCAGCATCCGG - Intronic
900594797 1:3475868-3475890 ACACCTGCCCAGCCAGCCTCTGG - Intronic
902448817 1:16484179-16484201 AGACGCTCCCTCCAGGCCTCTGG + Intergenic
902759453 1:18571727-18571749 AGACACCCCCAGCCCACCTCTGG + Intergenic
903378044 1:22878789-22878811 AGACGCTCCCATCCAGTCCCTGG - Intronic
904031614 1:27536817-27536839 AGAGGCTCCCAGCCTGCCCCGGG - Intronic
905343475 1:37295339-37295361 AGACTCTCACAGCCACCCCCAGG - Intergenic
905416546 1:37808208-37808230 TGACGCTCCCAGCCAGCTTCCGG + Exonic
905733231 1:40310592-40310614 AGATGCTCCCAGCTAGACACAGG + Intronic
905806261 1:40879969-40879991 GGCTGCTCACAGCCAGCCTCAGG + Intergenic
905871075 1:41404913-41404935 AGAAGGTCCCAGCCAGGCTCTGG - Intergenic
906374578 1:45284903-45284925 GGACCCTCCCAGCCAGGCGCAGG - Intronic
911202955 1:95064976-95064998 ACAAGCTCCCAAGCAGCCTCAGG + Exonic
911589376 1:99729020-99729042 AGAAGTTCCAAGCCAGCCTTGGG + Intronic
912385083 1:109267474-109267496 AGAACCTCTCAGCCAGTCTCAGG + Intronic
914841076 1:151249221-151249243 AGACACCCCCAGCCAGTTTCTGG + Intronic
916228125 1:162510381-162510403 TAACGCCCCCACCCAGCCTCTGG + Intronic
916373596 1:164126743-164126765 AGACCCTCCGAGCCAGGCACAGG + Intergenic
917535517 1:175871860-175871882 ATACCCTCCCAACCAGCCTCAGG + Intergenic
919801921 1:201359392-201359414 AGAAGCTTCCCTCCAGCCTCAGG - Intronic
920230497 1:204466803-204466825 AGACTCCCCCAGCCAGCATCGGG - Intronic
922830196 1:228548929-228548951 AGAGACTCCCAGCCAACCCCAGG - Intergenic
922950871 1:229558127-229558149 GGACCCTACCTGCCAGCCTCCGG + Exonic
1064263861 10:13808804-13808826 AGACCCTCCCACCTAGACTCTGG + Intronic
1067139921 10:43648522-43648544 AGACGCTGCCCTCCCGCCTCAGG + Intronic
1069769118 10:70886638-70886660 TCATGCTCCCAGGCAGCCTCTGG + Intronic
1070505479 10:77109171-77109193 AGACCCATCCAGCCAGCCACAGG - Intronic
1073192951 10:101665053-101665075 AGACACTGCCTCCCAGCCTCAGG - Intronic
1073250898 10:102119926-102119948 AAACGCTACCCGCCAGCCTGAGG + Intronic
1075414239 10:122250511-122250533 AGGAGCACCCAGCCAGCCCCAGG + Intronic
1075727547 10:124618252-124618274 AGAAGCCCCCCGCCAGCCCCTGG + Exonic
1077056091 11:593925-593947 AGACGCTCCCAGGAACCCTGAGG - Intronic
1077077774 11:709080-709102 AGAGCCTCCCAGTCAGCCTCTGG + Intronic
1077898740 11:6473721-6473743 AGACGCTCCGACCCAGACCCGGG + Intronic
1078079819 11:8195783-8195805 AGAACCACCCAGCCAGCCCCTGG - Intergenic
1082067206 11:47910630-47910652 AGAAGCTGCTGGCCAGCCTCTGG + Intergenic
1082890981 11:58138267-58138289 CGACGCTCCTGCCCAGCCTCAGG - Intronic
1083826214 11:65205451-65205473 AGAGGCTCCAGGCCAGCCCCCGG - Intronic
1085162424 11:74360755-74360777 GGACCCTCCGAGCCAGGCTCGGG - Intronic
1085371090 11:76006075-76006097 AGGGGCTCCTAGACAGCCTCAGG - Intronic
1085514684 11:77105361-77105383 GGAGGCTCCTGGCCAGCCTCAGG - Intronic
1088674196 11:112175764-112175786 AGAAGCTCCCAGCAACCTTCAGG - Intronic
1089332621 11:117700506-117700528 AGGAGCTCCCAGCCAGCCAAAGG + Intronic
1089764246 11:120751545-120751567 AGCCCCTCCCTGCCAGGCTCTGG + Intronic
1091167585 11:133493163-133493185 AGAGGCTCCCAGCCAGGATGGGG - Intronic
1095095410 12:38145334-38145356 AGGCTCTCTCAGCTAGCCTCTGG - Intergenic
1095866889 12:46982603-46982625 AGACGCTTTTAGCCTGCCTCAGG + Intergenic
1095970818 12:47901056-47901078 ATCCTCTCCCAGCCAGCCTTGGG + Intronic
1098844903 12:75523220-75523242 GGACCCTCCGAGCCAGACTCGGG + Intergenic
1099127196 12:78777061-78777083 AGGCCCTTCCAGCCAGCCTCTGG - Intergenic
1104966022 12:132509185-132509207 GGCCGCTCCCAGCCAGCCACTGG + Intronic
1104985606 12:132595100-132595122 AGATGCTCTCAGGCAGTCTCAGG + Intergenic
1106434375 13:29710843-29710865 GTAGGCTCCCAGCCAGCCACAGG + Intergenic
1108174091 13:47774281-47774303 AGATGCTGCCAGCCTGCTTCTGG - Intergenic
1112399047 13:99059614-99059636 AGAGGCTCTCAACCAACCTCAGG + Intronic
1113475015 13:110574367-110574389 AGAGGCTCCCACGCAGCCTCAGG + Intergenic
1113790024 13:113023356-113023378 AGACGCCCACAGGGAGCCTCGGG + Intronic
1115077936 14:29414086-29414108 GGACTCTCCCAGCCAGGCACGGG - Intergenic
1115502556 14:34062503-34062525 AGAGGCACCCAGCCCGCCCCAGG - Intronic
1116711355 14:48372042-48372064 GGACCCTCCCAGCCAGGCGCAGG + Intergenic
1118483372 14:66189515-66189537 GGACCCTCCCAGCCAGGCACGGG + Intergenic
1119358878 14:74031216-74031238 GGATCCTCCCACCCAGCCTCCGG + Intronic
1119703686 14:76771274-76771296 AGAAGCTCCAAGCCAGCCCTGGG - Intronic
1119704478 14:76775372-76775394 AGGTGCCCCCAGCCAGCCCCAGG - Intronic
1119880074 14:78092897-78092919 AGACCTTCCCAGCCAGGCTCTGG + Intergenic
1121341424 14:93107491-93107513 AGGCCCTCCCAGACAGCTTCAGG - Intronic
1122409661 14:101519314-101519336 AGTCCCTCCCAGCCAGCCACGGG - Intergenic
1122444896 14:101761433-101761455 AGTCGCTGCGAGCCGGCCTCAGG - Intergenic
1122883244 14:104699456-104699478 GGTCCCTCCCAGGCAGCCTCAGG - Intronic
1122900335 14:104779749-104779771 ACCCCCGCCCAGCCAGCCTCAGG + Intronic
1122915352 14:104855840-104855862 AGCTGCTCCCAGCCAGGCCCTGG + Intergenic
1123054889 14:105564657-105564679 AGACACACCCAGCCCGACTCGGG - Intergenic
1123079332 14:105684236-105684258 AGACACACCCAGCCCGACTCGGG - Intergenic
1202838012 14_GL000009v2_random:92908-92930 AGACCCTCCCAGCCATATTCTGG - Intergenic
1202907376 14_GL000194v1_random:82875-82897 AGACCCTCCCAGCCATGTTCTGG - Intergenic
1125574746 15:40747571-40747593 AGACTAACCCAGCCAGCCTTTGG + Intronic
1126463550 15:48939264-48939286 AGAGGCTCCAGACCAGCCTCAGG + Intronic
1128260182 15:66227870-66227892 AGCTGGGCCCAGCCAGCCTCTGG + Intronic
1131931597 15:97448873-97448895 GGCCGTTCCCAGCCAGACTCTGG + Intergenic
1132331467 15:101015044-101015066 GGATGAGCCCAGCCAGCCTCTGG + Intronic
1133133777 16:3694926-3694948 AGACCCTCCCTCCCAGCCTCAGG - Intronic
1133287419 16:4697124-4697146 AGCCTCTCCCGGCCAGGCTCAGG + Intronic
1134864482 16:17592579-17592601 AGATTCTGCCAGCCAGCCTGGGG + Intergenic
1135330278 16:21554738-21554760 AGATGCCCCGAGCCAGCCTGAGG - Intergenic
1135973382 16:27088488-27088510 ACATGCTCCCAGCCAGGCCCAGG + Intergenic
1136172451 16:28497061-28497083 AGCCCCTCCCCGCCTGCCTCTGG - Exonic
1137047806 16:35685019-35685041 AGAGACTCCCAGCCAACCCCAGG - Intergenic
1137047940 16:35685859-35685881 AGAGACTCCCAGCCGACCTCAGG - Intergenic
1137051272 16:35714755-35714777 AGAGACTCCCAGCCAACCCCAGG - Intergenic
1137317942 16:47347399-47347421 AGACCCTCCCAGCCATGCACAGG - Intronic
1139697777 16:68687456-68687478 TGACCCACCCAGTCAGCCTCAGG - Intronic
1139923768 16:70474734-70474756 AGAAGCTGCCAGCCTGGCTCTGG - Intronic
1139971413 16:70777926-70777948 AGACAGTCCCTGCCAGCCGCAGG - Intronic
1140258816 16:73359568-73359590 AGACACAGCCAGCCAGCCTCTGG - Intergenic
1141615996 16:85209712-85209734 AGACTCTCCCTCCCAGCCTCGGG - Intergenic
1142043318 16:87909270-87909292 AGATGCCCCGAGCCAGCCTGAGG - Intronic
1142220426 16:88851709-88851731 AGACCCTCCGAGCCAGGCCCGGG - Intronic
1142852897 17:2712689-2712711 AGGCCCTCCCAGCCCACCTCGGG - Intergenic
1143732375 17:8888409-8888431 AGAGGCTCCCTGCCCGCCTCAGG + Exonic
1148572050 17:48678230-48678252 AGACGCTCCCCGCCTGCTCCAGG + Intergenic
1150435652 17:65152242-65152264 GGACACTCCCAGCCAGCCTTGGG - Intronic
1150638457 17:66933159-66933181 GGTTGCTCCCAGCCAGCCTGGGG + Intergenic
1151453832 17:74214627-74214649 AGAATCTCCCAGCCCGTCTCAGG + Intronic
1151890285 17:76947442-76947464 AGAGCCTCACAGCCAGCCTGGGG + Intronic
1151939405 17:77283047-77283069 AGAGACTCCAAGCCTGCCTCAGG - Intronic
1153568782 18:6447261-6447283 AGACCCTCCCAGCCACCCACAGG - Intergenic
1154449055 18:14459923-14459945 CGACGCACCCAGACACCCTCAGG + Intergenic
1157730675 18:50001490-50001512 AGATGCTCCCAGTGAGGCTCAGG - Intronic
1159099340 18:63940706-63940728 GGACCCTCCCAGCCAGTCGCGGG - Intergenic
1160322146 18:77905828-77905850 AGACCCGCCCAGCCAGCCTGAGG - Intergenic
1160496521 18:79379199-79379221 GGAAACTCCCAGGCAGCCTCCGG - Intergenic
1161232393 19:3180775-3180797 ACACGCTCCCCGCCAGCCACAGG + Intergenic
1161283663 19:3458319-3458341 AGACGTTCCCAGCCTCCCGCAGG - Intronic
1161857084 19:6772304-6772326 AGATGCTCACAGGCAACCTCTGG + Intergenic
1163124782 19:15238987-15239009 AGAGGGTCCCAGTCAGCCTGGGG + Intronic
1163255738 19:16154729-16154751 AGACACACCAAGCTAGCCTCGGG + Intronic
1163885743 19:19963248-19963270 AGCCCATCCCAGGCAGCCTCCGG - Intergenic
1164370253 19:27637482-27637504 AGAGACTCCCAGCCAACCTCTGG - Intergenic
1164371434 19:27647524-27647546 AGAGGCTCCCAGCCCACCCCTGG - Intergenic
1164371940 19:27650956-27650978 AGAGACTCCCAGCTAGCCCCTGG - Intergenic
1164372860 19:27656924-27656946 AGAAACTCCCAGCCAGCCACAGG - Intergenic
1164376420 19:27691916-27691938 AGAGACTCCCAGCCAACCCCAGG - Intergenic
1164381932 19:27743138-27743160 AGAGGCTCCTGGCCAACCTCTGG - Intergenic
1164384539 19:27761779-27761801 AGAGGCTCCCAGACAACCTTAGG - Intergenic
1165154889 19:33780980-33781002 TGACGCCTCCAGCCTGCCTCTGG + Intergenic
1167469164 19:49665878-49665900 TGACGCTCCCAGCATGCCTCTGG - Exonic
1167740968 19:51324852-51324874 AGATGCTCACTACCAGCCTCTGG - Intronic
1168504469 19:56921691-56921713 AGGGGCTCCCGGACAGCCTCAGG + Intergenic
925877918 2:8328194-8328216 AGCCGAGCCCTGCCAGCCTCTGG + Intergenic
932413750 2:71561740-71561762 CGTCCCTCACAGCCAGCCTCTGG + Exonic
933277823 2:80302446-80302468 AGTGTTTCCCAGCCAGCCTCAGG - Exonic
933990410 2:87629855-87629877 AGACGCAGCCAGCCACCCTTTGG - Intergenic
934551678 2:95266806-95266828 AGACGCTCCCTGCCAAGGTCTGG - Intergenic
934997426 2:98978161-98978183 GGACCCTCCCAGCCAGGCACAGG - Intergenic
935739090 2:106130817-106130839 AGAGTCTCCCAGCCTGCTTCAGG - Intronic
936303436 2:111320969-111320991 AGACGCAGCCAGCCACCCTTTGG + Intergenic
937130721 2:119510420-119510442 AGGCGCTCCCAGCAACCCTGGGG - Intronic
948334010 2:237193788-237193810 AGATGATCTCATCCAGCCTCAGG - Intergenic
948724900 2:239928686-239928708 AGAGGCACCCAGCCAACCACCGG + Intronic
948909192 2:240994512-240994534 GGAGGGTCCCATCCAGCCTCTGG + Intergenic
1170832769 20:19857654-19857676 AGACACTCCCATGCACCCTCTGG - Intergenic
1171138430 20:22719457-22719479 AGACGCTTCCTGCCTGCCTCGGG + Intergenic
1171374284 20:24681709-24681731 ACACTGACCCAGCCAGCCTCAGG + Intergenic
1171910708 20:30949780-30949802 AGACCCTCCGAGCCAGGTTCAGG + Intergenic
1172134239 20:32676279-32676301 TGATGCTCCCTGGCAGCCTCTGG + Intergenic
1172392940 20:34578589-34578611 AGAAGCTCACTGGCAGCCTCTGG + Intronic
1173479938 20:43390524-43390546 AGCTGATGCCAGCCAGCCTCCGG + Intergenic
1173570050 20:44070185-44070207 CCCCGCTCCCAGCCAGGCTCGGG + Intergenic
1175552143 20:59824464-59824486 AGGCTCTCCCAGCCAGACTCTGG - Intronic
1176194338 20:63830648-63830670 AGACGCCCCCGGGCTGCCTCGGG + Intronic
1178627851 21:34233211-34233233 AGATCCTCCCTCCCAGCCTCAGG - Intergenic
1178888627 21:36501783-36501805 CCAGGCTCCCAGCCAGCCCCTGG + Intronic
1179063546 21:38003098-38003120 AGTGGTTGCCAGCCAGCCTCTGG + Intronic
1179480431 21:41673313-41673335 AGATGCGCCCGGCCAGCCTGTGG + Intergenic
1180180939 21:46118458-46118480 AGCAGCCCCCAGCCAGCATCTGG + Intronic
1180600221 22:17010589-17010611 AGACCCTCCCCGACAGCCACCGG - Intergenic
1180800568 22:18630037-18630059 ACACCCTCCCAGCCAGCCGCTGG + Intergenic
1180851800 22:19025594-19025616 ACACCCTCCCAGCCAGCCGCTGG + Intergenic
1181221151 22:21365225-21365247 ACACCCTCCCAGCCAGCCGCTGG - Intergenic
1181920567 22:26317365-26317387 AGAAGATCCCACCCAGCCCCAGG + Intronic
1182089438 22:27584012-27584034 GGCCCCTCCCAGCCAGCCCCAGG + Intergenic
1183734452 22:39636129-39636151 TCTCGCTCCCAGCCTGCCTCTGG - Intronic
1184649554 22:45913345-45913367 AGCCGCTCTCAGACAGGCTCTGG - Intergenic
1185106722 22:48875091-48875113 AGAGGCTGGCAGCCAGACTCAGG + Intergenic
1185250673 22:49800012-49800034 ACGCGCGCCCTGCCAGCCTCAGG + Intronic
1185322339 22:50207546-50207568 AGAGGCCCACAGGCAGCCTCAGG - Intronic
950138839 3:10601455-10601477 AGACTCTCACAGCCAGCCTGGGG - Intronic
950188509 3:10960255-10960277 TCACCCTCCCTGCCAGCCTCAGG + Intergenic
950336767 3:12200935-12200957 AGAGGCTCCGTGTCAGCCTCTGG + Intergenic
951611399 3:24495351-24495373 AGACGCCCCCTGCCAGGCTCCGG + Intergenic
951991617 3:28681576-28681598 AGACTCACTCACCCAGCCTCTGG + Intergenic
952777604 3:37061188-37061210 CACCGCGCCCAGCCAGCCTCAGG - Intronic
952827623 3:37537380-37537402 AGAGCCTCACAGCAAGCCTCTGG + Intronic
953513144 3:43563835-43563857 ACACACACCCACCCAGCCTCTGG - Intronic
953804470 3:46056089-46056111 AGACAGTCCCAGCCAGCCTAAGG - Intergenic
957028624 3:75214571-75214593 AGTCGCCCCCAGCCCGACTCCGG + Intergenic
961305838 3:125958837-125958859 GGCCGCTCCCAGCTAGCCACTGG + Intergenic
961653305 3:128428175-128428197 TGAAGCTCCCAGCCTGGCTCTGG + Intergenic
963595228 3:147317422-147317444 GGACCCTCCGAGCCAGGCTCAGG + Intergenic
966307329 3:178551199-178551221 AAGCCCTCACAGCCAGCCTCTGG - Intronic
966962555 3:184954465-184954487 GGAGGCTCCTGGCCAGCCTCAGG - Intronic
969465632 4:7354610-7354632 AGAAGCTCCCAGATGGCCTCTGG - Intronic
969483900 4:7461046-7461068 AGAAGCTTCCAGCAAGCTTCAGG - Intronic
972883437 4:43454948-43454970 ACCCTCTCCCTGCCAGCCTCTGG + Intergenic
973396025 4:49593676-49593698 AGACCCTCCCAGCCATGTTCTGG - Intergenic
973396345 4:49596489-49596511 AGACCCTCCCAGCCATGTTCTGG - Intergenic
978300226 4:107260344-107260366 AGACGCTCACATTCTGCCTCTGG + Intronic
980134866 4:128849076-128849098 ACACGCTGTCAGCCAGCGTCCGG - Exonic
981299088 4:143166801-143166823 GGACGCTCCCAGCCATGCGCGGG - Intergenic
984015226 4:174417679-174417701 GGACCCTCCCAGCCAGGCGCAGG + Intergenic
985718028 5:1473546-1473568 AGAGGCTCCCCGCCAGCCTGTGG - Intronic
985885071 5:2671164-2671186 AGAGGCTGCCGGCCACCCTCTGG + Intergenic
986350812 5:6878047-6878069 TCACGTTCCCAGCCACCCTCAGG + Intergenic
997264860 5:132489694-132489716 AGCCCCTCCCAGCCAGTCTCTGG + Intronic
997465351 5:134084417-134084439 AGACACTCCAAGCCAGACCCTGG + Intergenic
997618331 5:135268509-135268531 CACCGCTCCCAGCCAGCATCCGG - Intronic
998856583 5:146400292-146400314 AGCCGCTAGCAGCCAGCATCTGG - Intergenic
1001296829 5:170504341-170504363 AGCCGCTCCCCGCGAGCCTTCGG - Intronic
1002077496 5:176717665-176717687 AGACGCTCCCCGCCAAGATCTGG + Intergenic
1002197341 5:177508623-177508645 AAACGCTCCCAGCCAGGAGCGGG + Intronic
1002277678 5:178114151-178114173 AGCCGCTCCCGGCAGGCCTCAGG + Intronic
1002318900 5:178363517-178363539 CTACACTCCCAGCCAGACTCTGG + Intronic
1002418295 5:179132230-179132252 AGACGCCACCAGCCACCATCTGG - Exonic
1002443147 5:179274659-179274681 AGAGGCTCCCAGCCAGCAACAGG - Intronic
1003654123 6:7989550-7989572 AGACACCCCCAGCCAGTTTCTGG + Intronic
1006396146 6:33788833-33788855 TGGCTCTCCCAGCCGGCCTCGGG - Exonic
1011264006 6:85497025-85497047 AGACGCCCCCACCCCGCCCCTGG + Intergenic
1015257002 6:131189117-131189139 AGCTGCTCCCAGCCAGTCACAGG - Intronic
1016307920 6:142702806-142702828 AGAAGCTCACAGTCAGCCTCCGG + Intergenic
1016389194 6:143558057-143558079 AGAAGCTCCCAGGCAGCATGTGG - Intronic
1019436687 7:1025824-1025846 AGAGGACCCCAGCCTGCCTCTGG - Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1031988123 7:128177031-128177053 CCACACACCCAGCCAGCCTCTGG - Intergenic
1032390446 7:131552347-131552369 AGCCACTCCTAGCCACCCTCAGG - Intronic
1035574274 8:695180-695202 AGGGGCTCACAGCCAGCCCCTGG + Intronic
1037650997 8:20838486-20838508 AAATGCTCCAAGCCAGCCGCTGG + Intergenic
1039893077 8:41697479-41697501 AGATGCTCCCAGCCACCTTGGGG + Intronic
1045060735 8:98408703-98408725 GAGCGCTGCCAGCCAGCCTCTGG - Intronic
1045110829 8:98938627-98938649 AGACCCTCCTGCCCAGCCTCAGG + Intronic
1048176521 8:132157526-132157548 ACACTCTCCCAGCCAGCCACTGG - Intronic
1048621107 8:136133784-136133806 AAACTCTGCCAGTCAGCCTCTGG + Intergenic
1049107260 8:140622218-140622240 ATTCGCTCCCACCCAGCCCCTGG - Intronic
1049259164 8:141629573-141629595 CCTGGCTCCCAGCCAGCCTCTGG + Intergenic
1049409610 8:142466591-142466613 AGCCCCTCCCACCCAGCCGCTGG - Intronic
1049591586 8:143465269-143465291 GGACACTCCCACCCAGCCTGGGG - Intronic
1049690070 8:143954423-143954445 TGCCTCTCCCACCCAGCCTCAGG + Intronic
1049744645 8:144258120-144258142 AGACTCTCCCTGCCAGTTTCTGG + Intronic
1049906069 9:217365-217387 GAAAGCTCCCAGCCAGCCACTGG - Intronic
1053294205 9:36901369-36901391 AAGCCCTCCCACCCAGCCTCGGG + Intronic
1053299252 9:36936950-36936972 AGGCATACCCAGCCAGCCTCAGG + Intronic
1055883565 9:81032069-81032091 AGAGGCTCCCAGCAAGTCTCAGG - Intergenic
1058602499 9:106685016-106685038 AGACCCTCCAAACCAGCCCCAGG - Intergenic
1061048454 9:128180221-128180243 GGAAGCTCCCAGCCAGACTCTGG - Intronic
1061266964 9:129511744-129511766 CGATGACCCCAGCCAGCCTCAGG + Intergenic
1061291126 9:129650934-129650956 TGAAGCTCCCAGCAAGCCTGGGG + Intergenic
1061423504 9:130484972-130484994 CCACCCTCCCAGGCAGCCTCCGG - Intronic
1061609171 9:131734993-131735015 TGAAACTCCCAGCCAGCCTGTGG + Intronic
1062601045 9:137318718-137318740 AGACCCTCCCTGCCTGGCTCAGG + Intronic
1062733474 9:138121702-138121724 AGACCCCCTCAGCCAGCCCCTGG + Exonic
1186514572 X:10156939-10156961 TGATGCTCCCAGCCGGCCTCCGG + Intronic
1187219789 X:17312811-17312833 AGACCCTGCCAGCCAGCCTGTGG + Intergenic
1189336611 X:40174352-40174374 AGACGCTCCCAGCCAGCCTCCGG + Intronic
1190054304 X:47173051-47173073 AGAGGCCTCCAGCCAGCCTCAGG + Intronic
1190054670 X:47174706-47174728 AGACCTGCCCAGCCAGCCTGGGG - Intronic
1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG + Intergenic
1190879934 X:54484857-54484879 AGCCCCACCCAGCCAGCGTCTGG + Intronic
1191244451 X:58214914-58214936 AGAGACTCCCAGCCTACCTCAGG + Intergenic
1191248907 X:58249784-58249806 AGAGACTCCTAGCCAACCTCAGG + Intergenic
1191646972 X:63492431-63492453 GGACCCTCCGAGCCAGCCGCGGG - Intergenic
1192056503 X:67779232-67779254 ACCAGCTCCCAGCCTGCCTCTGG + Intergenic
1192558307 X:72107869-72107891 AGACCCTGTCAGCCAGCCTGAGG + Intergenic
1195671334 X:107472686-107472708 AGAGGGGCCCAGCCAGCCCCAGG + Intergenic
1199792085 X:151164794-151164816 AGACGCTTCCCTCCAGCCTTTGG - Intergenic
1201163254 Y:11183031-11183053 AGACCCTCCCAGCCATGTTCTGG - Intergenic