ID: 1189345420

View in Genome Browser
Species Human (GRCh38)
Location X:40237516-40237538
Sequence CCACCATGCCTGGCTAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189345416_1189345420 5 Left 1189345416 X:40237488-40237510 CCCGAGTAGGTGGGATTACAGGT 0: 320
1: 32452
2: 154677
3: 256044
4: 208327
Right 1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG No data
1189345417_1189345420 4 Left 1189345417 X:40237489-40237511 CCGAGTAGGTGGGATTACAGGTG 0: 357
1: 29173
2: 80424
3: 169618
4: 230428
Right 1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG No data
1189345409_1189345420 21 Left 1189345409 X:40237472-40237494 CCTTCTGCCTCAGCCTCCCGAGT 0: 141
1: 3287
2: 16533
3: 32570
4: 87375
Right 1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG No data
1189345412_1189345420 14 Left 1189345412 X:40237479-40237501 CCTCAGCCTCCCGAGTAGGTGGG 0: 945
1: 103301
2: 284909
3: 226195
4: 127508
Right 1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG No data
1189345414_1189345420 8 Left 1189345414 X:40237485-40237507 CCTCCCGAGTAGGTGGGATTACA 0: 460
1: 48326
2: 214416
3: 254924
4: 187156
Right 1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189345420 Original CRISPR CCACCATGCCTGGCTAAAAG TGG Intergenic
No off target data available for this crispr