ID: 1189348340

View in Genome Browser
Species Human (GRCh38)
Location X:40259145-40259167
Sequence GGCAGGGAGCAACAGCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189348340_1189348343 -3 Left 1189348340 X:40259145-40259167 CCTGGTTGCTGTTGCTCCCTGCC No data
Right 1189348343 X:40259165-40259187 GCCCATCTCTCCCCTTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189348340 Original CRISPR GGCAGGGAGCAACAGCAACC AGG (reversed) Intergenic
No off target data available for this crispr