ID: 1189349688

View in Genome Browser
Species Human (GRCh38)
Location X:40267252-40267274
Sequence GGCTTCCCATTTAACCTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189349677_1189349688 26 Left 1189349677 X:40267203-40267225 CCTGGAGCCTCCGCGCATAGCAC 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1189349688 X:40267252-40267274 GGCTTCCCATTTAACCTCTAAGG No data
1189349683_1189349688 4 Left 1189349683 X:40267225-40267247 CCGGGGCGTTTTTTCCTTCCAGC No data
Right 1189349688 X:40267252-40267274 GGCTTCCCATTTAACCTCTAAGG No data
1189349676_1189349688 29 Left 1189349676 X:40267200-40267222 CCGCCTGGAGCCTCCGCGCATAG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1189349688 X:40267252-40267274 GGCTTCCCATTTAACCTCTAAGG No data
1189349682_1189349688 16 Left 1189349682 X:40267213-40267235 CCGCGCATAGCACCGGGGCGTTT 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1189349688 X:40267252-40267274 GGCTTCCCATTTAACCTCTAAGG No data
1189349686_1189349688 -10 Left 1189349686 X:40267239-40267261 CCTTCCAGCTGGAGGCTTCCCAT No data
Right 1189349688 X:40267252-40267274 GGCTTCCCATTTAACCTCTAAGG No data
1189349681_1189349688 19 Left 1189349681 X:40267210-40267232 CCTCCGCGCATAGCACCGGGGCG 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1189349688 X:40267252-40267274 GGCTTCCCATTTAACCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189349688 Original CRISPR GGCTTCCCATTTAACCTCTA AGG Intergenic
No off target data available for this crispr