ID: 1189350752

View in Genome Browser
Species Human (GRCh38)
Location X:40273806-40273828
Sequence CTGTCGGACAGCGCTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189350752_1189350761 27 Left 1189350752 X:40273806-40273828 CCCAGAGCAGCGCTGTCCGACAG No data
Right 1189350761 X:40273856-40273878 CTATCTGTGCTGTCCAACAGGGG No data
1189350752_1189350759 25 Left 1189350752 X:40273806-40273828 CCCAGAGCAGCGCTGTCCGACAG No data
Right 1189350759 X:40273854-40273876 TTCTATCTGTGCTGTCCAACAGG No data
1189350752_1189350756 0 Left 1189350752 X:40273806-40273828 CCCAGAGCAGCGCTGTCCGACAG No data
Right 1189350756 X:40273829-40273851 AACCCTCTGTGAGCATGGAAAGG No data
1189350752_1189350755 -5 Left 1189350752 X:40273806-40273828 CCCAGAGCAGCGCTGTCCGACAG No data
Right 1189350755 X:40273824-40273846 GACAGAACCCTCTGTGAGCATGG No data
1189350752_1189350760 26 Left 1189350752 X:40273806-40273828 CCCAGAGCAGCGCTGTCCGACAG No data
Right 1189350760 X:40273855-40273877 TCTATCTGTGCTGTCCAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189350752 Original CRISPR CTGTCGGACAGCGCTGCTCT GGG (reversed) Intergenic